Human MSI2/FLJ36569/MGC3245 ORF/cDNA clone-Adenovirus particle (BC001526)

Cat. No.: vGMAP000181

Pre-made Human MSI2/FLJ36569/MGC3245 Adenovirus for MSI2 overexpression in-vitro and in-vivo. The MSI2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MSI2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to MSI2/FLJ36569 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000181 Human MSI2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000181
Gene Name MSI2
Accession Number BC001526
Gene ID 124540
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 987 bp
Gene Alias FLJ36569,MGC3245,MSI2H
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGGAGGCAAATGGGAGCCAAGGCACCTCGGGCAGCGCCAACGACTCCCAGCACGACCCCGGTAAAATGTTTATCGGTGGACTGAGCTGGCAGACCTCACCAGATAGCCTTAGAGACTATTTTAGCAAATTTGGAGAAATTAGAGAATGTATGGTCATGAGAGATCCCACTACGAAACGCTCCAGAGGCTTCGGTTTCGTCACGTTCGCAGACCCAGCAAGTGTAGATAAAGTATTAGGTCAGCCCCACCATGAGTTAGATTCCAAGACGATTGACCCCAAAGTTGCATTTCCTCGTCGAGCGCAACCCAAGATGGTCACGAGAACAAAGAAAATATTTGTAGGCGGGTTATCTGCGAACACAGTAGTGGAAGATGTAAAGCAATATTTCGAGCAGTTTGGCAAGGTGGAAGATGCAATGCTGATGTTTGATAAAACTACCAACAGGCACAGAGGGTTTGGCTTTGTCACTTTTGAGAATGAAGATGTTGTGGAGAAAGTCTGTGAGATTCATTTCCATGAAATCAATAATAAAATGGTAGAATGTAAGAAAGCTCAGCCGAAAGAAGTCATGTTCCCACCTGGGACAAGAGGCCGGGCCCGGGGACTGCCTTACACCATGGACGCGTTCATGCTTGGCATGGGGATGCTGGGATATCCCAACTTCGTGGCGACCTATGGCCGTGGCTACCCCGGATTTGCTCCAAGCTATGGCTATCAGTTCCCAGGCTTCCCAGCAGCGGCTTATGGACCAGTGGCAGCAGCGGCGGTGGCGGCAGCAAGAGGATCAGGCTCCAACCCGGCGCGGCCCGGAGGCTTCCCGGGGGCCAACAGCCCAGGACCTGTCGCCGATCTCTACGGCCCTGCCAGCCAGGACTCCGGAGTGGGGAATTACATAAGTGCGGCCAGCCCACAGCCGGGCTCGGGCTTCGGCCACGGCATAGCTGGACCTTTGATTGCAACGGCCTTTACAAATGGATACCATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35817-Ab Anti-MSI2 monoclonal antibody
    Target Antigen GM-Tg-g-T35817-Ag MSI2 protein
    ORF Viral Vector pGMLV000033 Human MSI2 Lentivirus plasmid
    ORF Viral Vector pGMAP000181 Human MSI2 Adenovirus plasmid
    ORF Viral Vector vGMLV000033 Human MSI2 Lentivirus particle
    ORF Viral Vector vGMAP000181 Human MSI2 Adenovirus particle


    Target information

    Target ID GM-T35817
    Target Name MSI2
    Gene ID 124540, 76626, 100423536, 360596, 101084147, 475148, 505542, 100070744
    Gene Symbol and Synonyms 1700105C15Rik,MSI2,MSI2H,RGD1560397
    Uniprot Accession Q96DH6
    Uniprot Entry Name MSI2H_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000153944
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.