Human MSI2/FLJ36569/MGC3245 ORF/cDNA clone-Adenovirus plasmid (BC001526)

SKU: pGMAP000181
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MSI2/FLJ36569/MGC3245 adenoviral expression plasmid for MSI2 adenovirus packaging, MSI2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to MSI2/FLJ36569 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000181
Gene Name MSI2
Accession Number BC001526
Gene ID 124540
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 987 bp
Gene Alias FLJ36569,MGC3245,MSI2H
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGGAGGCAAATGGGAGCCAAGGCACCTCGGGCAGCGCCAACGACTCCCAGCACGACCCCGGTAAAATGTTTATCGGTGGACTGAGCTGGCAGACCTCACCAGATAGCCTTAGAGACTATTTTAGCAAATTTGGAGAAATTAGAGAATGTATGGTCATGAGAGATCCCACTACGAAACGCTCCAGAGGCTTCGGTTTCGTCACGTTCGCAGACCCAGCAAGTGTAGATAAAGTATTAGGTCAGCCCCACCATGAGTTAGATTCCAAGACGATTGACCCCAAAGTTGCATTTCCTCGTCGAGCGCAACCCAAGATGGTCACGAGAACAAAGAAAATATTTGTAGGCGGGTTATCTGCGAACACAGTAGTGGAAGATGTAAAGCAATATTTCGAGCAGTTTGGCAAGGTGGAAGATGCAATGCTGATGTTTGATAAAACTACCAACAGGCACAGAGGGTTTGGCTTTGTCACTTTTGAGAATGAAGATGTTGTGGAGAAAGTCTGTGAGATTCATTTCCATGAAATCAATAATAAAATGGTAGAATGTAAGAAAGCTCAGCCGAAAGAAGTCATGTTCCCACCTGGGACAAGAGGCCGGGCCCGGGGACTGCCTTACACCATGGACGCGTTCATGCTTGGCATGGGGATGCTGGGATATCCCAACTTCGTGGCGACCTATGGCCGTGGCTACCCCGGATTTGCTCCAAGCTATGGCTATCAGTTCCCAGGCTTCCCAGCAGCGGCTTATGGACCAGTGGCAGCAGCGGCGGTGGCGGCAGCAAGAGGATCAGGCTCCAACCCGGCGCGGCCCGGAGGCTTCCCGGGGGCCAACAGCCCAGGACCTGTCGCCGATCTCTACGGCCCTGCCAGCCAGGACTCCGGAGTGGGGAATTACATAAGTGCGGCCAGCCCACAGCCGGGCTCGGGCTTCGGCCACGGCATAGCTGGACCTTTGATTGCAACGGCCTTTACAAATGGATACCATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35817-Ab Anti-MSI2 monoclonal antibody
    Target Antigen GM-Tg-g-T35817-Ag MSI2 protein
    ORF Viral Vector pGMLV000033 Human MSI2 Lentivirus plasmid
    ORF Viral Vector pGMAP000181 Human MSI2 Adenovirus plasmid
    ORF Viral Vector vGMLV000033 Human MSI2 Lentivirus particle
    ORF Viral Vector vGMAP000181 Human MSI2 Adenovirus particle


    Target information

    Target ID GM-T35817
    Target Name MSI2
    Gene ID 124540, 76626, 100423536, 360596, 101084147, 475148, 505542, 100070744
    Gene Symbol and Synonyms 1700105C15Rik,MSI2,MSI2H,RGD1560397
    Uniprot Accession Q96DH6
    Uniprot Entry Name MSI2H_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000153944
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.