Human IL1A/IL-1A/IL1-ALPHA ORF/cDNA clone-Adenovirus particle (BC013142)

Cat. No.: vGMAP000157

Pre-made Human IL1A/IL-1A/IL1-ALPHA Adenovirus for IL1A overexpression in-vitro and in-vivo. The IL1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to IL1A/IL-1A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000157 Human IL1A Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000157
Gene Name IL1A
Accession Number BC013142
Gene ID 3552
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 816 bp
Gene Alias IL-1A,IL1-ALPHA,IL1F1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCAAAGTTCCAGACATGTTTGAAGACCTGAAGAACTGTTACAGTGAAAATGAAGAAGACAGTTCCTCCATTGATCATCTGTCTCTGAATCAGAAATCCTTCTATCATGTAAGCTATGGCCCACTCCATGAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCTTACCTTCAAGGAGAGCATGGTGGTAGTAGCAACCAACGGGAAGGTTCTGAAGAAGAGACGGTTGAGTTTAAGCCAATCCATCACTGATGATGACCTGGAGGCCATCGCCAATGACTCAGAGGAAGAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGCAATGTGAAATACAACTTTATGAGGATCATCAAATACGAATTCATCCTGAATGACGCCCTCAATCAAAGTATAATTCGAGCCAATGATCAGTACCTCACGGCTGCTGCATTACATAATCTGGATGAAGCAGTGAAATTTGACATGGGTGCTTATAAGTCATCAAAGGATGATGCTAAAATTACCGTGATTCTAAGAATCTCAAAAACTCAATTGTATGTGACTGCCCAAGATGAAGACCAACCAGTGCTGCTGAAGGAGATGCCTGAGATACCCAAAACCATCACAGGTAGTGAGACCAACCTCCTCTTCTTCTGGGAAACTCACGGCACTAAGAACTATTTCACATCAGTTGCCCATCCAAACTTGTTTATTGCCACAAAGCAAGACTACTGGGTGTGCTTGGCAGGGGGGCCACCCTCTATCACTGACTTTCAGATACTGGAAAACCAGGCGTAG
ORF Protein Sequence MAKVPDMFEDLKNCYSENEEDSSSIDHLSLNQKSFYHVSYGPLHEGCMDQSVSLSISETSKTSKLTFKESMVVVATNGKVLKKRRLSLSQSITDDDLEAIANDSEEEIIKPRSAPFSFLSNVKYNFMRIIKYEFILNDALNQSIIRANDQYLTAAALHNLDEAVKFDMGAYKSSKDDAKITVILRISKTQLYVTAQDEDQPVLLKEMPEIPKTITGSETNLLFFWETHGTKNYFTSVAHPNLFIATKQDYWVCLAGGPPSITDFQILENQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-063 Pre-Made Bermekimab biosimilar, Whole mAb, Anti-IL1A Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha therapeutic antibody
    Biosimilar GMP-Bios-ab-331 Pre-Made Lutikizumab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL1A;IL1B Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha;IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody
    Target Antibody GM-Tg-g-T16340-Ab Anti-IL1A/ IL-1A/ IL1 monoclonal antibody
    Target Antigen GM-Tg-g-T16340-Ag IL1A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T16340 interleukin 1, alpha (IL1A) protein & antibody
    ORF Viral Vector pGMAP000157 Human IL1A Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-001 Human IL1A Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-084 Human IL1A Adenovirus plasmid
    ORF Viral Vector vGMAP000157 Human IL1A Adenovirus particle
    ORF Viral Vector vGMLP-IL-001 Human IL1A Lentivirus particle
    ORF Viral Vector vGMAP-IL-084 Human IL1A Adenovirus particle


    Target information

    Target ID GM-T16340
    Target Name IL1A
    Gene ID 3552, 16175, 700193, 24493, 493944, 403782, 281250, 100064969
    Gene Symbol and Synonyms IL-1 alpha,IL-1A,IL-1F1,IL1,IL1-ALPHA,IL1A,IL1F1,L1A
    Uniprot Accession P01583
    Uniprot Entry Name IL1A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Sarcoidosis, ovarian cancer, Urinary bladder urothelial carcinoma
    Gene Ensembl ENSG00000115008
    Target Classification Not Available

    The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.