Human IL1A/IL-1A/IL1 ORF/cDNA clone-Adenovirus particle (NM_000575)
Cat. No.: vGMAP-IL-084
Pre-made Human IL1A/IL-1A/IL1 Adenovirus for IL1A overexpression in-vitro and in-vivo. The IL1A adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL1A-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IL1A/IL-1A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP-IL-084 | Human IL1A Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP-IL-084 |
Gene Name | IL1A |
Accession Number | NM_000575 |
Gene ID | 3552 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 816 bp |
Gene Alias | IL-1A,IL1,IL1-ALPHA,IL1F1 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGGCCAAAGTTCCAGACATGTTTGAAGACCTGAAGAACTGTTACAGTGAAAATGAAGAAGACAGTTCCTCCATTGATCATCTGTCTCTGAATCAGAAATCCTTCTATCATGTAAGCTATGGCCCACTCCATGAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCTTACCTTCAAGGAGAGCATGGTGGTAGTAGCAACCAACGGGAAGGTTCTGAAGAAGAGACGGTTGAGTTTAAGCCAATCCATCACTGATGATGACCTGGAGGCCATCGCCAATGACTCAGAGGAAGAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGCAATGTGAAATACAACTTTATGAGGATCATCAAATACGAATTCATCCTGAATGACGCCCTCAATCAAAGTATAATTCGAGCCAATGATCAGTACCTCACGGCTGCTGCATTACATAATCTGGATGAAGCAGTGAAATTTGACATGGGTGCTTATAAGTCATCAAAGGATGATGCTAAAATTACCGTGATTCTAAGAATCTCAAAAACTCAATTGTATGTGACTGCCCAAGATGAAGACCAACCAGTGCTGCTGAAGGAGATGCCTGAGATACCCAAAACCATCACAGGTAGTGAGACCAACCTCCTCTTCTTCTGGGAAACTCACGGCACTAAGAACTATTTCACATCAGTTGCCCATCCAAACTTGTTTATTGCCACAAAGCAAGACTACTGGGTGTGCTTGGCAGGGGGGCCACCCTCTATCACTGACTTTCAGATACTGGAAAACCAGGCGTAG |
ORF Protein Sequence | MAKVPDMFEDLKNCYSENEEDSSSIDHLSLNQKSFYHVSYGPLHEGCMDQSVSLSISETSKTSKLTFKESMVVVATNGKVLKKRRLSLSQSITDDDLEAIANDSEEEIIKPRSAPFSFLSNVKYNFMRIIKYEFILNDALNQSIIRANDQYLTAAALHNLDEAVKFDMGAYKSSKDDAKITVILRISKTQLYVTAQDEDQPVLLKEMPEIPKTITGSETNLLFFWETHGTKNYFTSVAHPNLFIATKQDYWVCLAGGPPSITDFQILENQA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-063 | Pre-Made Bermekimab biosimilar, Whole mAb, Anti-IL1A Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha therapeutic antibody |
Biosimilar | GMP-Bios-ab-331 | Pre-Made Lutikizumab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL1A;IL1B Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha;IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody |
Target Antibody | GM-Tg-g-T16340-Ab | Anti-IL1A/ IL-1A/ IL1 monoclonal antibody |
Target Antigen | GM-Tg-g-T16340-Ag | IL1A VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T16340 | interleukin 1, alpha (IL1A) protein & antibody |
ORF Viral Vector | pGMAP000157 | Human IL1A Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-001 | Human IL1A Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-084 | Human IL1A Adenovirus plasmid |
ORF Viral Vector | vGMAP000157 | Human IL1A Adenovirus particle |
ORF Viral Vector | vGMLP-IL-001 | Human IL1A Lentivirus particle |
ORF Viral Vector | vGMAP-IL-084 | Human IL1A Adenovirus particle |
Target information
Target ID | GM-T16340 |
Target Name | IL1A |
Gene ID | 3552, 16175, 700193, 24493, 493944, 403782, 281250, 100064969 |
Gene Symbol and Synonyms | IL-1 alpha,IL-1A,IL-1F1,IL1,IL1-ALPHA,IL1A,IL1F1,L1A |
Uniprot Accession | P01583 |
Uniprot Entry Name | IL1A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Sarcoidosis, ovarian cancer, Urinary bladder urothelial carcinoma |
Gene Ensembl | ENSG00000115008 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.