Human IGFBP5/IBP5 ORF/cDNA clone-Adenovirus particle (NM_000599.4)

Cat. No.: vGMAD001653

Pre-made Human IGFBP5/IBP5 Adenovirus for IGFBP5 overexpression in-vitro and in-vivo. The IGFBP5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IGFBP5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to IGFBP5/IBP5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001653 Human IGFBP5 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001653
Gene Name IGFBP5
Accession Number NM_000599.4
Gene ID 3488
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 819 bp
Gene Alias IBP5
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAACGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA
ORF Protein Sequence MVLLTAVLLLLAAYAGPAQSLGSFVHCEPCDEKALSMCPPSPLGCELVKEPGCGCCMTCALAEGQSCGVYTERCAQGLRCLPRQDEEKPLHALLHGRGVCLNEKSYREQVKIERDSREHEEPTTSEMAEETYSPKIFRPKHTRISELKAEAVKKDRRKKLTQSKFVGGAENTAHPRIISAPEMRQESEQGPCRRHMEASLQELKASPRMVPRAVYLPNCDRKGFYKRKQCKPSRGRKRGICWCVDKYGMKLPGMEYVDGDFQCHTFDSSNVE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0987-Ab Anti-IBP5/ IGFBP5 functional antibody
    Target Antigen GM-Tg-g-SE0987-Ag IGFBP5 protein
    Cytokine cks-Tg-g-GM-SE0987 insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody
    ORF Viral Vector pGMLP000569 Human IGFBP5 Lentivirus plasmid
    ORF Viral Vector pGMAD001653 Human IGFBP5 Adenovirus plasmid
    ORF Viral Vector vGMLP000569 Human IGFBP5 Lentivirus particle
    ORF Viral Vector vGMAD001653 Human IGFBP5 Adenovirus particle


    Target information

    Target ID GM-SE0987
    Target Name IGFBP5
    Gene ID 3488, 16011, 696339, 25285, 101084305, 610316, 404185, 100034063
    Gene Symbol and Synonyms IBP5,IGF-BP5,IGFBP-5,IGFBP-5P,IGFBP5
    Uniprot Accession P24593
    Uniprot Entry Name IBP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer, Dent disease
    Gene Ensembl ENSG00000115461
    Target Classification Not Available

    Enables insulin-like growth factor I binding activity. Involved in several processes, including cellular response to cAMP; regulation of smooth muscle cell migration; and regulation of smooth muscle cell proliferation. Part of insulin-like growth factor ternary complex. Biomarker of pulmonary fibrosis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.