Human IGFBP5/IBP5 ORF/cDNA clone-Adenovirus plasmid (NM_000599.4)

Cat. No.: pGMAD001653
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IGFBP5/IBP5 adenoviral expression plasmid for IGFBP5 adenovirus packaging, IGFBP5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IGFBP5/IBP5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD001653
Gene Name IGFBP5
Accession Number NM_000599.4
Gene ID 3488
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 819 bp
Gene Alias IBP5
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGTGTTGCTCACCGCGGTCCTCCTGCTGCTGGCCGCCTATGCGGGGCCGGCCCAGAGCCTGGGCTCCTTCGTGCACTGCGAGCCCTGCGACGAGAAAGCCCTCTCCATGTGCCCCCCCAGCCCCCTGGGCTGCGAGCTGGTCAAGGAGCCGGGCTGCGGCTGCTGCATGACCTGCGCCCTGGCCGAGGGGCAGTCGTGCGGCGTCTACACCGAGCGCTGCGCCCAGGGGCTGCGCTGCCTCCCCCGGCAGGACGAGGAGAAGCCGCTGCACGCCCTGCTGCACGGCCGCGGGGTTTGCCTCAACGAAAAGAGCTACCGCGAGCAAGTCAAGATCGAGAGAGACTCCCGTGAGCACGAGGAGCCCACCACCTCTGAGATGGCCGAGGAGACCTACTCCCCCAAGATCTTCCGGCCCAAACACACCCGCATCTCCGAGCTGAAGGCTGAAGCAGTGAAGAAGGACCGCAGAAAGAAGCTGACCCAGTCCAAGTTTGTCGGGGGAGCCGAGAACACTGCCCACCCCCGGATCATCTCTGCACCTGAGATGAGACAGGAGTCTGAGCAGGGCCCCTGCCGCAGACACATGGAGGCTTCCCTGCAGGAGCTCAAAGCCAGCCCACGCATGGTGCCCCGTGCTGTGTACCTGCCCAATTGTGACCGCAAAGGATTCTACAAGAGAAAGCAGTGCAAACCTTCCCGTGGCCGCAAACGTGGCATCTGCTGGTGCGTGGACAAGTACGGGATGAAGCTGCCAGGCATGGAGTACGTTGACGGGGACTTTCAGTGCCACACCTTCGACAGCAGCAACGTTGAGTGA
ORF Protein Sequence MVLLTAVLLLLAAYAGPAQSLGSFVHCEPCDEKALSMCPPSPLGCELVKEPGCGCCMTCALAEGQSCGVYTERCAQGLRCLPRQDEEKPLHALLHGRGVCLNEKSYREQVKIERDSREHEEPTTSEMAEETYSPKIFRPKHTRISELKAEAVKKDRRKKLTQSKFVGGAENTAHPRIISAPEMRQESEQGPCRRHMEASLQELKASPRMVPRAVYLPNCDRKGFYKRKQCKPSRGRKRGICWCVDKYGMKLPGMEYVDGDFQCHTFDSSNVE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0987-Ab Anti-IBP5/ IGFBP5 functional antibody
    Target Antigen GM-Tg-g-SE0987-Ag IGFBP5 protein
    Cytokine cks-Tg-g-GM-SE0987 insulin-like growth factor binding protein 5 (IGFBP5) protein & antibody
    ORF Viral Vector pGMLP000569 Human IGFBP5 Lentivirus plasmid
    ORF Viral Vector pGMAD001653 Human IGFBP5 Adenovirus plasmid
    ORF Viral Vector vGMLP000569 Human IGFBP5 Lentivirus particle
    ORF Viral Vector vGMAD001653 Human IGFBP5 Adenovirus particle


    Target information

    Target ID GM-SE0987
    Target Name IGFBP5
    Gene ID 3488, 16011, 696339, 25285, 101084305, 610316, 404185, 100034063
    Gene Symbol and Synonyms IBP5,IGF-BP5,IGFBP-5,IGFBP-5P,IGFBP5
    Uniprot Accession P24593
    Uniprot Entry Name IBP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer, Dent disease
    Gene Ensembl ENSG00000115461
    Target Classification Not Available

    Enables insulin-like growth factor I binding activity. Involved in several processes, including cellular response to cAMP; regulation of smooth muscle cell migration; and regulation of smooth muscle cell proliferation. Part of insulin-like growth factor ternary complex. Biomarker of pulmonary fibrosis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.