Human GREM1/C15DUPq/CKTSF1B1 ORF/cDNA clone-Adenovirus particle (NM_013372.7)

Cat. No.: vGMAD000730

Pre-made Human GREM1/C15DUPq/CKTSF1B1 Adenovirus for GREM1 overexpression in-vitro and in-vivo. The GREM1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GREM1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to Gremlin-1/GREM1/C15DUPq products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000730 Human GREM1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000730
Gene Name GREM1
Accession Number NM_013372.7
Gene ID 26585
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 555 bp
Gene Alias C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,GREMLIN,HMPS,HMPS1,IHG-2,MPSH,PIG2
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGCCGCACAGCCTACACGGTGGGAGCCCTGCTTCTCCTCTTGGGGACCCTGCTGCCGGCTGCTGAAGGGAAAAAGAAAGGGTCCCAAGGTGCCATCCCCCCGCCAGACAAGGCCCAGCACAATGACTCAGAGCAGACTCAGTCGCCCCAGCAGCCTGGCTCCAGGAACCGGGGGCGGGGCCAAGGGCGGGGCACTGCCATGCCCGGGGAGGAGGTGCTGGAGTCCAGCCAAGAGGCCCTGCATGTGACGGAGCGCAAATACCTGAAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAA
ORF Protein Sequence MSRTAYTVGALLLLLGTLLPAAEGKKKGSQGAIPPPDKAQHNDSEQTQSPQQPGSRNRGRGQGRGTAMPGEEVLESSQEALHVTERKYLKRDWCKTQPLKQTIHEEGCNSRTIINRFCYGQCNSFYIPRHIRKEEGSFQSCSFCKPKKFTTMMVTLNCPELQPPTKKKRVTRVKQCRCISIDLD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-669 Pre-Made Ginisortamab biosimilar, Whole mAb, Anti-GREM1/Gremlin-1 Antibody: Anti-C15DUPq/CKTSF1B1/CRAC1/CRCS4/DAND2/DRM/DUP15q/GREMLIN/HMPS/HMPS1/IHG-2/MPSH/PIG2 therapeutic antibody
    Target Antibody GM-Tg-g-T22104-Ab Anti-GREM1/ Gremlin-1/ C15DUPq functional antibody
    Target Antigen GM-Tg-g-T22104-Ag Gremlin-1/GREM1 protein
    ORF Viral Vector pGMLP000730 Human GREM1 Lentivirus plasmid
    ORF Viral Vector pGMAD000730 Human GREM1 Adenovirus plasmid
    ORF Viral Vector vGMLP000730 Human GREM1 Lentivirus particle
    ORF Viral Vector vGMAD000730 Human GREM1 Adenovirus particle


    Target information

    Target ID GM-T22104
    Target Name Gremlin-1
    Gene ID 26585, 23892, 574176, 50566, 101096735, 487475, 539079, 100057765
    Gene Symbol and Synonyms C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,Grem,GREM1,GREMLIN,gremlin-1,HMPS,HMPS1,IHG-2,ld,MPSH,PIG2
    Uniprot Accession O60565
    Uniprot Entry Name GREM1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000166923
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted glycosylated protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to relay the sonic hedgehog (SHH) signal from the polarizing region to the apical ectodermal ridge during limb bud outgrowth. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.