Human GREM1/C15DUPq/CKTSF1B1 ORF/cDNA clone-Adenovirus plasmid (NM_013372.7)

Cat. No.: pGMAD000730
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GREM1/C15DUPq/CKTSF1B1 adenoviral expression plasmid for GREM1 adenovirus packaging, GREM1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to Gremlin-1/GREM1/C15DUPq products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000730
Gene Name GREM1
Accession Number NM_013372.7
Gene ID 26585
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,GREMLIN,HMPS,HMPS1,IHG-2,MPSH,PIG2
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGCCGCACAGCCTACACGGTGGGAGCCCTGCTTCTCCTCTTGGGGACCCTGCTGCCGGCTGCTGAAGGGAAAAAGAAAGGGTCCCAAGGTGCCATCCCCCCGCCAGACAAGGCCCAGCACAATGACTCAGAGCAGACTCAGTCGCCCCAGCAGCCTGGCTCCAGGAACCGGGGGCGGGGCCAAGGGCGGGGCACTGCCATGCCCGGGGAGGAGGTGCTGGAGTCCAGCCAAGAGGCCCTGCATGTGACGGAGCGCAAATACCTGAAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAA
ORF Protein Sequence MSRTAYTVGALLLLLGTLLPAAEGKKKGSQGAIPPPDKAQHNDSEQTQSPQQPGSRNRGRGQGRGTAMPGEEVLESSQEALHVTERKYLKRDWCKTQPLKQTIHEEGCNSRTIINRFCYGQCNSFYIPRHIRKEEGSFQSCSFCKPKKFTTMMVTLNCPELQPPTKKKRVTRVKQCRCISIDLD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-669 Pre-Made Ginisortamab biosimilar, Whole mAb, Anti-GREM1/Gremlin-1 Antibody: Anti-C15DUPq/CKTSF1B1/CRAC1/CRCS4/DAND2/DRM/DUP15q/GREMLIN/HMPS/HMPS1/IHG-2/MPSH/PIG2 therapeutic antibody
    Target Antibody GM-Tg-g-T22104-Ab Anti-GREM1/ Gremlin-1/ C15DUPq functional antibody
    Target Antigen GM-Tg-g-T22104-Ag Gremlin-1/GREM1 protein
    ORF Viral Vector pGMLP000730 Human GREM1 Lentivirus plasmid
    ORF Viral Vector pGMAD000730 Human GREM1 Adenovirus plasmid
    ORF Viral Vector vGMLP000730 Human GREM1 Lentivirus particle
    ORF Viral Vector vGMAD000730 Human GREM1 Adenovirus particle


    Target information

    Target ID GM-T22104
    Target Name Gremlin-1
    Gene ID 26585, 23892, 574176, 50566, 101096735, 487475, 539079, 100057765
    Gene Symbol and Synonyms C15DUPq,CKTSF1B1,CRAC1,CRCS4,DAND2,DRM,DUP15q,Grem,GREM1,GREMLIN,gremlin-1,HMPS,HMPS1,IHG-2,ld,MPSH,PIG2
    Uniprot Accession O60565
    Uniprot Entry Name GREM1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000166923
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted glycosylated protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to relay the sonic hedgehog (SHH) signal from the polarizing region to the apical ectodermal ridge during limb bud outgrowth. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.