Human GSK3B ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001146156.2)
Pre-made Human GSK3B/ Non-Viral expression plasmid (overexpression vector) for mouse GSK3B overexpression in unique cell transient transfection and stable cell line development.
Go
to GSK-3B/GSK3B/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000726 | Human GSK3B Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000726 |
Gene Name | GSK3B |
Accession Number | NM_001146156.2 |
Gene ID | 2932 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1263 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCTTCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTGGTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAACTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGGTACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTATGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGATAGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAAATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCTTGGACTAAGGTCTTCCGACCCCGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCCCGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAATGTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTGTCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCTGCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAGACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T70977 |
Target Name | GSK-3B |
Gene ID | 2932, 56637, 713114, 84027, 101081660, 478575, 790875, 100061033 |
Gene Symbol and Synonyms | 7330414F15Rik,8430431H08Rik,GSK-3,GSK-3beta,GSK3,GSK3B,GSK3beta |
Uniprot Accession | P49841 |
Uniprot Entry Name | GSK3B_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000082701 |
Target Classification | Kinase |
The protein encoded by this gene is a serine-threonine kinase belonging to the glycogen synthase kinase subfamily. It is a negative regulator of glucose homeostasis and is involved in energy metabolism, inflammation, ER-stress, mitochondrial dysfunction, and apoptotic pathways. Defects in this gene have been associated with Parkinson disease and Alzheimer disease. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.