Human CAV1/BSCL3/ CGL3 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001753.5)

Pre-made Human CAV1/BSCL3/ CGL3 Non-Viral expression plasmid (overexpression vector) for mouse CAV1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to CAV1/BSCL3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000357 Human CAV1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000357
Gene Name CAV1
Accession Number NM_001753.5
Gene ID 857
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 537 bp
Gene Alias BSCL3, CGL3, LCCNS, MSTP085, PPH3, VIP21
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCTGGGGGCAAATACGTAGACTCGGAGGGACATCTCTACACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93945-Ab Anti-CAV1/ BSCL3/ CGL3 monoclonal antibody
    Target Antigen GM-Tg-g-T93945-Ag CAV1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000315 Human CAV1 Lentivirus plasmid
    ORF Viral Vector pGMLV000316 Human CAV1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000856 Human CAV1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000357 Human CAV1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000373 Human CAV1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000101 Human CAV1 Adenovirus plasmid
    ORF Viral Vector vGMLV000315 Human CAV1 Lentivirus particle
    ORF Viral Vector vGMLV000316 Human CAV1 Lentivirus particle
    ORF Viral Vector vGMAAV000856 Human CAV1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000101 Human CAV1 Adenovirus particle


    Target information

    Target ID GM-T93945
    Target Name CAV1
    Gene ID 857, 12389, 704449, 25404, 493668, 403980, 281040, 100055975
    Gene Symbol and Synonyms BSCL3,Cav,Cav-1,CAV1,Caveolin-1,CGL3,LCCNS,MSTP085,PPH3,VIP21
    Uniprot Accession Q03135
    Uniprot Entry Name CAV1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000105974
    Target Classification Not Available

    The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.