Human CAV1/MSTP085/VIP21 ORF/cDNA clone-Adenovirus plasmid (BC009685)
SKU: pGMAP000101
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CAV1/MSTP085/VIP21 adenoviral expression plasmid for CAV1 adenovirus packaging, CAV1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
CAV1/MSTP085 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAP000101 |
Gene Name | CAV1 |
Accession Number | BC009685 |
Gene ID | 857 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 537 bp |
Gene Alias | MSTP085,VIP21 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Kanamycin |
Sequence | ATGTCTGGGGGCAAATACGTAGACTCGGAGGGACATCTCTACACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T93945-Ab | Anti-CAV1/ BSCL3/ CGL3 monoclonal antibody |
Target Antigen | GM-Tg-g-T93945-Ag | CAV1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000315 | Human CAV1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000316 | Human CAV1 Lentivirus plasmid |
ORF Viral Vector | pGMAD001567 | Human CAV1 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000856 | Human CAV1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000101 | Human CAV1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000357 | Human CAV1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000373 | Human CAV1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000315 | Human CAV1 Lentivirus particle |
ORF Viral Vector | vGMLV000316 | Human CAV1 Lentivirus particle |
ORF Viral Vector | vGMAD001567 | Human CAV1 Adenovirus particle |
ORF Viral Vector | vGMAAV000856 | Human CAV1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000101 | Human CAV1 Adenovirus particle |
Target information
Target ID | GM-T93945 |
Target Name | CAV1 |
Gene ID | 857, 12389, 704449, 25404, 493668, 403980, 281040, 100055975 |
Gene Symbol and Synonyms | BSCL3,Cav,Cav-1,CAV1,Caveolin-1,CGL3,LCCNS,MSTP085,PPH3,VIP21 |
Uniprot Accession | Q03135 |
Uniprot Entry Name | CAV1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000105974 |
Target Classification | Not Available |
The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.