Human KLF4/EZF/GKLF ORF/cDNA clone-Lentivirus plasmid (NM_001314052.2)

SKU: pGMLV002425
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KLF4/EZF/GKLF Lentiviral expression plasmid for KLF4 lentivirus packaging, KLF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to KLF4/EZF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $778.02
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLV002425
Gene Name KLF4
Accession Number NM_001314052.2
Gene ID 9314
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1542 bp
Gene Alias EZF,GKLF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACCGAGGAGTTCAACGATCTCCTGGACCTGGACTTTATTCTCTCCAATTCGCTGACCCATCCTCCGGAGTCAGTGGCCGCCACCGTGTCCTCGTCAGCGTCAGCCTCCTCTTCGTCGTCGCCGTCGAGCAGCGGCCCTGCCAGCGCGCCCTCCACCTGCAGCTTCACCTATCCGATCCGGGCCGGGAACGACCCGGGCGTGGCGCCGGGCGGCACGGGCGGAGGCCTCCTCTATGGCAGGGAGTCCGCTCCCCCTCCGACGGCTCCCTTCAACCTGGCGGACATCAACGACGTGAGCCCCTCGGGCGGCTTCGTGGCCGAGCTCCTGCGGCCAGAATTGGACCCGGTGTACATTCCGCCGCAGCAGCCGCAGCCGCCAGGTGGCGGGCTGATGGGCAAGTTCGTGCTGAAGGCGTCGCTGAGCGCCCCTGGCAGCGAGTACGGCAGCCCGTCGGTCATCAGCGTCAGCAAAGGCAGCCCTGACGGCAGCCACCCGGTGGTGGTGGCGCCCTACAACGGCGGGCCGCCGCGCACGTGCCCCAAGATCAAGCAGGAGGCGGTCTCTTCGTGCACCCACTTGGGCGCTGGACCCCCTCTCAGCAATGGCCACCGGCCGGCTGCACACGACTTCCCCCTGGGGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTCTTGAGGAAGTGCTGAGCAGCAGGGACTGTCACCCTGCCCTGCCGCTTCCTCCCGGCTTCCATCCCCACCCGGGGCCCAATTACCCATCCTTCCTGCCCGATCAGATGCAGCCGCAAGTCCCGCCGCTCCATTACCAAGGTCAGTCCCGGGGATTTGTAGCTCGGGCTGGGGAGCCCTGTGTGTGCTGGCCCCACTTCGGGACACACGGGATGATGCTCACCCCACCTTCTTCACCCCTAGAGCTCATGCCACCCGGTTCCTGCATGCCAGAGGAGCCCAAGCCAAAGAGGGGAAGACGATCGTGGCCCCGGAAAAGGACCGCCACCCACACTTGTGATTACGCGGGCTGCGGCAAAACCTACACAAAGAGTTCCCATCTCAAGGCACACCTGCGAACCCACACAGGTGAGAAACCTTACCACTGTGACTGGGACGGCTGTGGATGGAAATTCGCCCGCTCAGATGAACTGACCAGGCACTACCGTAAACACACGGGGCACCGCCCGTTCCAGTGCCAAAAATGCGACCGAGCATTTTCCAGGTCGGACCACCTCGCCTTACACATGAAGAGGCATTTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T81916-Ab Anti-KLF4 monoclonal antibody
    Target Antigen GM-Tg-g-T81916-Ag KLF4 protein
    ORF Viral Vector pGMLV000247 Human KLF4 Lentivirus plasmid
    ORF Viral Vector pGMLV002172 Human KLF4 Lentivirus plasmid
    ORF Viral Vector pGMLV002425 Human KLF4 Lentivirus plasmid
    ORF Viral Vector pGMAD000164 Human KLF4 Adenovirus plasmid
    ORF Viral Vector pGMAD000806 Human KLF4 Adenovirus plasmid
    ORF Viral Vector pGMAD001331 Human KLF4 Adenovirus plasmid
    ORF Viral Vector pGMPC001122 Human KLF4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000247 Human KLF4 Lentivirus particle
    ORF Viral Vector vGMLV002172 Human KLF4 Lentivirus particle
    ORF Viral Vector vGMLV002425 Human KLF4 Lentivirus particle
    ORF Viral Vector vGMAD000164 Human KLF4 Adenovirus particle
    ORF Viral Vector vGMAD000806 Human KLF4 Adenovirus particle
    ORF Viral Vector vGMAD001331 Human KLF4 Adenovirus particle


    Target information

    Target ID GM-T81916
    Target Name KLF4
    Gene ID 9314, 16600, 711169, 114505, 100379626, 481657, 520842, 100054047
    Gene Symbol and Synonyms EZF,GKLF,KLF4,Zie
    Uniprot Accession O43474
    Uniprot Entry Name KLF4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000136826
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.