Human KLF4/EZF/GKLF ORF/cDNA clone-Lentivirus plasmid (NM_001314052.2)
SKU: pGMLV002172
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KLF4/EZF/GKLF Lentiviral expression plasmid for KLF4 lentivirus packaging, KLF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
KLF4/EZF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV002172 |
Gene Name | KLF4 |
Accession Number | NM_001314052.2 |
Gene ID | 9314 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1542 bp |
Gene Alias | EZF,GKLF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCAGCCACCTGGCGAGTCTGACATGGCTGTCAGCGACGCGCTGCTCCCATCTTTCTCCACGTTCGCGTCTGGCCCGGCGGGAAGGGAGAAGACACTGCGTCAAGCAGGTGCCCCGAATAACCGCTGGCGGGAGGAGCTCTCCCACATGAAGCGACTTCCCCCAGTGCTTCCCGGCCGCCCCTATGACCTGGCGGCGGCGACCGTGGCCACAGACCTGGAGAGCGGCGGAGCCGGTGCGGCTTGCGGCGGTAGCAACCTGGCGCCCCTACCTCGGAGAGAGACCGAGGAGTTCAACGATCTCCTGGACCTGGACTTTATTCTCTCCAATTCGCTGACCCATCCTCCGGAGTCAGTGGCCGCCACCGTGTCCTCGTCAGCGTCAGCCTCCTCTTCGTCGTCGCCGTCGAGCAGCGGCCCTGCCAGCGCGCCCTCCACCTGCAGCTTCACCTATCCGATCCGGGCCGGGAACGACCCGGGCGTGGCGCCGGGCGGCACGGGCGGAGGCCTCCTCTATGGCAGGGAGTCCGCTCCCCCTCCGACGGCTCCCTTCAACCTGGCGGACATCAACGACGTGAGCCCCTCGGGCGGCTTCGTGGCCGAGCTCCTGCGGCCAGAATTGGACCCGGTGTACATTCCGCCGCAGCAGCCGCAGCCGCCAGGTGGCGGGCTGATGGGCAAGTTCGTGCTGAAGGCGTCGCTGAGCGCCCCTGGCAGCGAGTACGGCAGCCCGTCGGTCATCAGCGTCAGCAAAGGCAGCCCTGACGGCAGCCACCCGGTGGTGGTGGCGCCCTACAACGGCGGGCCGCCGCGCACGTGCCCCAAGATCAAGCAGGAGGCGGTCTCTTCGTGCACCCACTTGGGCGCTGGACCCCCTCTCAGCAATGGCCACCGGCCGGCTGCACACGACTTCCCCCTGGGGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTCTTGAGGAAGTGCTGAGCAGCAGGGACTGTCACCCTGCCCTGCCGCTTCCTCCCGGCTTCCATCCCCACCCGGGGCCCAATTACCCATCCTTCCTGCCCGATCAGATGCAGCCGCAAGTCCCGCCGCTCCATTACCAAGGTCAGTCCCGGGGATTTGTAGCTCGGGCTGGGGAGCCCTGTGTGTGCTGGCCCCACTTCGGGACACACGGGATGATGCTCACCCCACCTTCTTCACCCCTAGAGCTCATGCCACCCGGTTCCTGCATGCCAGAGGAGCCCAAGCCAAAGAGGGGAAGACGATCGTGGCCCCGGAAAAGGACCGCCACCCACACTTGTGATTACGCGGGCTGCGGCAAAACCTACACAAAGAGTTCCCATCTCAAGGCACACCTGCGAACCCACACAGGTGAGAAACCTTACCACTGTGACTGGGACGGCTGTGGATGGAAATTCGCCCGCTCAGATGAACTGACCAGGCACTACCGTAAACACACGGGGCACCGCCCGTTCCAGTGCCAAAAATGCGACCGAGCATTTTCCAGGTCGGACCACCTCGCCTTACACATGAAGAGGCATTTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T81916-Ab | Anti-KLF4 monoclonal antibody |
Target Antigen | GM-Tg-g-T81916-Ag | KLF4 protein |
ORF Viral Vector | pGMLV000247 | Human KLF4 Lentivirus plasmid |
ORF Viral Vector | pGMLV002172 | Human KLF4 Lentivirus plasmid |
ORF Viral Vector | pGMLV002425 | Human KLF4 Lentivirus plasmid |
ORF Viral Vector | pGMAD000164 | Human KLF4 Adenovirus plasmid |
ORF Viral Vector | pGMAD000806 | Human KLF4 Adenovirus plasmid |
ORF Viral Vector | pGMAD001331 | Human KLF4 Adenovirus plasmid |
ORF Viral Vector | pGMPC001122 | Human KLF4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000247 | Human KLF4 Lentivirus particle |
ORF Viral Vector | vGMLV002172 | Human KLF4 Lentivirus particle |
ORF Viral Vector | vGMLV002425 | Human KLF4 Lentivirus particle |
ORF Viral Vector | vGMAD000164 | Human KLF4 Adenovirus particle |
ORF Viral Vector | vGMAD000806 | Human KLF4 Adenovirus particle |
ORF Viral Vector | vGMAD001331 | Human KLF4 Adenovirus particle |
Target information
Target ID | GM-T81916 |
Target Name | KLF4 |
Gene ID | 9314, 16600, 711169, 114505, 100379626, 481657, 520842, 100054047 |
Gene Symbol and Synonyms | EZF,GKLF,KLF4,Zie |
Uniprot Accession | O43474 |
Uniprot Entry Name | KLF4_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000136826 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.