Human PRDX6/1-Cys/aiPLA2 ORF/cDNA clone-Lentivirus plasmid (NM_004905)

Cat. No.: pGMLV002157
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PRDX6/1-Cys/aiPLA2 Lentiviral expression plasmid for PRDX6 lentivirus packaging, PRDX6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PRDX6/1-Cys products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $468.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002157
Gene Name PRDX6
Accession Number NM_004905
Gene ID 9588
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 675 bp
Gene Alias 1-Cys,aiPLA2,AOP2,HEL-S-128m,LPCAT-5,NSGPx,p29,PRX
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCATGGGGCATTCTCTTCTCCCACCCTCGGGACTTTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTTGCCTGGAGCAAGGATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGATGATAGGAATCGGGAGCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTGGTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAAAGGGTTGCCACCCCAGTTGATTGGAAGGATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAACTTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATACCTCCGCTACACACCCCAGCCTTAA
ORF Protein Sequence MPGGLLLGDVAPNFEANTTVGRIRFHDFLGDSWGILFSHPRDFTPVCTTELGRAAKLAPEFAKRNVKLIALSIDSVEDHLAWSKDINAYNCEEPTEKLPFPIIDDRNRELAILLGMLDPAEKDEKGMPVTARVVFVFGPDKKLKLSILYPATTGRNFDEILRVVISLQLTAEKRVATPVDWKDGDSVMVLPTIPEEEAKKLFPKGVFTKELPSGKKYLRYTPQP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0601-Ab Anti-PRDX6/ 1-Cys/ AOP2 functional antibody
    Target Antigen GM-Tg-g-SE0601-Ag PRDX6 protein
    ORF Viral Vector pGMLP002689 Human PRDX6 Lentivirus plasmid
    ORF Viral Vector pGMLV002157 Human PRDX6 Lentivirus plasmid
    ORF Viral Vector vGMLP002689 Human PRDX6 Lentivirus particle
    ORF Viral Vector vGMLV002157 Human PRDX6 Lentivirus particle


    Target information

    Target ID GM-SE0601
    Target Name PRDX6
    Gene ID 9588, 11758, 706486, 94167, 101092729, 480069, 282438, 100052382
    Gene Symbol and Synonyms 1-Cys,1-Cys Prx,1-cysPrx,9430088D19Rik,aiPLA2,AOP2,Brp-12,CP-3,GPx,HEL-S-128m,LPCAT-5,Ltw-4,Ltw4,Lvtw-4,NSGPx,ORF06,p29,Prdx5,PRDX6,PRX
    Uniprot Accession P30041
    Uniprot Entry Name PRDX6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000117592
    Target Classification Not Available

    The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.