Human PRDX6/1-Cys/aiPLA2 ORF/cDNA clone-Lentivirus plasmid (NM_004905)
Cat. No.: pGMLP002689
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PRDX6/1-Cys/aiPLA2 Lentiviral expression plasmid for PRDX6 lentivirus packaging, PRDX6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PRDX6/1-Cys products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002689 |
Gene Name | PRDX6 |
Accession Number | NM_004905 |
Gene ID | 9588 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 675 bp |
Gene Alias | 1-Cys,aiPLA2,AOP2,HEL-S-128m,NSGPx,p29,PRX |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTCATGGGGCATTCTCTTCTCCCACCCTCGGGACTTTACCCCAGTGTGCACCACAGAGCTTGGCAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTCAATAGACAGTGTTGAGGACCATCTTGCCTGGAGCAAGGATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGATGATAGGAATCGGGAGCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAAAAGGGCATGCCTGTGACAGCTCGTGTGGTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACTGGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAAAGGGTTGCCACCCCAGTTGATTGGAAGGATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAACTTTTCCCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATACCTCCGCTACACACCCCAGCCTTAA |
ORF Protein Sequence | MPGGLLLGDVAPNFEANTTVGRIRFHDFLGDSWGILFSHPRDFTPVCTTELGRAAKLAPEFAKRNVKLIALSIDSVEDHLAWSKDINAYNCEEPTEKLPFPIIDDRNRELAILLGMLDPAEKDEKGMPVTARVVFVFGPDKKLKLSILYPATTGRNFDEILRVVISLQLTAEKRVATPVDWKDGDSVMVLPTIPEEEAKKLFPKGVFTKELPSGKKYLRYTPQP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0601-Ab | Anti-PRDX6/ 1-Cys/ AOP2 functional antibody |
Target Antigen | GM-Tg-g-SE0601-Ag | PRDX6 protein |
ORF Viral Vector | pGMLP002689 | Human PRDX6 Lentivirus plasmid |
ORF Viral Vector | pGMLV002157 | Human PRDX6 Lentivirus plasmid |
ORF Viral Vector | vGMLP002689 | Human PRDX6 Lentivirus particle |
ORF Viral Vector | vGMLV002157 | Human PRDX6 Lentivirus particle |
Target information
Target ID | GM-SE0601 |
Target Name | PRDX6 |
Gene ID | 9588, 11758, 706486, 94167, 101092729, 480069, 282438, 100052382 |
Gene Symbol and Synonyms | 1-Cys,1-Cys Prx,1-cysPrx,9430088D19Rik,aiPLA2,AOP2,Brp-12,CP-3,GPx,HEL-S-128m,LPCAT-5,Ltw-4,Ltw4,Lvtw-4,NSGPx,ORF06,p29,Prdx5,PRDX6,PRX |
Uniprot Accession | P30041 |
Uniprot Entry Name | PRDX6_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000117592 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.