Human SNCA/NACP/ PARK1 ORF/cDNA clone-Lentivirus plasmid (NM_000345.4)

Pre-made Human SNCA/NACP/ PARK1 Lentiviral expression plasmid for SNCA lentivirus packaging, SNCA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SNCA/NACP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001108 Human SNCA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001108
Gene Name SNCA
Accession Number NM_000345.4
Gene ID 6622
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 423 bp
Gene Alias NACP, PARK1, PARK4, PD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-106 Pre-Made Cinpanemab biosimilar, Whole mAb, Anti-SNCA Antibody: Anti-NACP/PARK1/PARK4/PD1 therapeutic antibody
    Biosimilar GMP-Bios-ab-455 Pre-Made Prasinezumab biosimilar, Whole mAb, Anti-SNCA Antibody: Anti-NACP/PARK1/PARK4/PD1 therapeutic antibody
    Target Antibody GM-Tg-g-T03644-Ab Anti-SYUA/ SNCA/ NACP monoclonal antibody
    Target Antigen GM-Tg-g-T03644-Ag SNCA VLP (virus-like particle)
    ORF Viral Vector pGMLV000451 Human SNCA Lentivirus plasmid
    ORF Viral Vector pGMLV000666 Human SNCA Lentivirus plasmid
    ORF Viral Vector pGMLV001108 Human SNCA Lentivirus plasmid
    ORF Viral Vector pGMLV001492 Human SNCA Lentivirus plasmid
    ORF Viral Vector pGMAD000007 Human SNCA Adenovirus plasmid
    ORF Viral Vector pGMAAV000133 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000397 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000411 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000557 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000965 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000966 Human SNCA Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000427 Human SNCA Adenovirus plasmid
    ORF Viral Vector vGMLV000451 Human SNCA Lentivirus particle
    ORF Viral Vector vGMLV000666 Human SNCA Lentivirus particle
    ORF Viral Vector vGMLV001108 Human SNCA Lentivirus particle
    ORF Viral Vector vGMLV001492 Human SNCA Lentivirus particle
    ORF Viral Vector vGMAD000007 Human SNCA Adenovirus particle
    ORF Viral Vector vGMAAV000133 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000397 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000411 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000557 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000965 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000966 Human SNCA Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000427 Human SNCA Adenovirus particle


    Target information

    Target ID GM-T03644
    Target Name SNCA
    Gene ID 6622, 20617, 706985, 29219, 101091694, 478478, 282857, 100053270
    Gene Symbol and Synonyms alpha-Syn,alphaSYN,NACP,PARK1,PARK4,PD1,SNCA
    Uniprot Accession P37840
    Uniprot Entry Name SYUA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000145335
    Target Classification Not Available

    Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.