Human CCR2/CC-CKR-2/CCR-2 ORF/cDNA clone-Lentivirus plasmid (NM_001123041.2)
Cat. No.: pGMLV000474
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCR2/CC-CKR-2/CCR-2 Lentiviral expression plasmid for CCR2 lentivirus packaging, CCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CCR2/CC-CKR-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000474 |
Gene Name | CCR2 |
Accession Number | NM_001123041.2 |
Gene ID | 729230 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1125 bp |
Gene Alias | CC-CKR-2,CCR-2,CCR2A,CCR2B,CD192,CKR2,CKR2A,CKR2B,CMKBR2,MCP-1-R |
Fluorescent Reporter | ZsGreen-Firefly luciferase |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGTCCACATCTCGTTCTCGGTTTATCAGAAATACCAACGAGAGCGGTGAAGAAGTCACCACCTTTTTTGATTATGATTACGGTGCTCCCTGTCATAAATTTGACGTGAAGCAAATTGGGGCCCAACTCCTGCCTCCGCTCTACTCGCTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCGTCCTCATCTTAATAAACTGCAAAAAGCTGAAGTGCTTGACTGACATTTACCTGCTCAACCTGGCCATCTCTGATCTGCTTTTTCTTATTACTCTCCCATTGTGGGCTCACTCTGCTGCAAATGAGTGGGTCTTTGGGAATGCAATGTGCAAATTATTCACAGGGCTGTATCACATCGGTTATTTTGGCGGAATCTTCTTCATCATCCTCCTGACAATCGATAGATACCTGGCTATTGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACCTGGTTGGTGGCTGTGTTTGCTTCTGTCCCAGGAATCATCTTTACTAAATGCCAGAAAGAAGATTCTGTTTATGTCTGTGGCCCTTATTTTCCACGAGGATGGAATAATTTCCACACAATAATGAGGAACATTTTGGGGCTGGTCCTGCCGCTGCTCATCATGGTCATCTGCTACTCGGGAATCCTGAAAACCCTGCTTCGGTGTCGAAACGAGAAGAAGAGGCATAGGGCAGTGAGAGTCATCTTCACCATCATGATTGTTTACTTTCTCTTCTGGACTCCCTATAATATTGTCATTCTCCTGAACACCTTCCAGGAATTCTTCGGCCTGAGTAACTGTGAAAGCACCAGTCAACTGGACCAAGCCACGCAGGTGACAGAGACTCTTGGGATGACTCACTGCTGCATCAATCCCATCATCTATGCCTTCGTTGGGGAGAAGTTCAGAAGCCTTTTTCACATAGCTCTTGGCTGTAGGATTGCCCCACTCCAAAAACCAGTGTGTGGAGGTCCAGGAGTGAGACCAGGAAAGAATGTGAAAGTGACTACACAAGGACTCCTCGATGGTCGTGGAAAAGGAAAGTCAATTGGCAGAGCCCCTGAAGCCAGTCTTCAGGACAAAGAAGGAGCCTAG |
ORF Protein Sequence | MLSTSRSRFIRNTNESGEEVTTFFDYDYGAPCHKFDVKQIGAQLLPPLYSLVFIFGFVGNMLVVLILINCKKLKCLTDIYLLNLAISDLLFLITLPLWAHSAANEWVFGNAMCKLFTGLYHIGYFGGIFFIILLTIDRYLAIVHAVFALKARTVTFGVVTSVITWLVAVFASVPGIIFTKCQKEDSVYVCGPYFPRGWNNFHTIMRNILGLVLPLLIMVICYSGILKTLLRCRNEKKRHRAVRVIFTIMIVYFLFWTPYNIVILLNTFQEFFGLSNCESTSQLDQATQVTETLGMTHCCINPIIYAFVGEKFRSLFHIALGCRIAPLQKPVCGGPGVRPGKNVKVTTQGLLDGRGKGKSIGRAPEASLQDKEGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-447 | Pre-Made Plozalizumab biosimilar, Whole mAb, Anti-CCR2 Antibody: Anti-CKR2/CD192/CKR2A/CKR2B/CMKBR2/MCP-1-R/CC-CKR-2 therapeutic antibody |
Target Antibody | GM-Tg-g-T89988-Ab | Anti-CCR2/ CC-CKR-2/ CCR-2A monoclonal antibody |
Target Antigen | GM-Tg-g-T89988-Ag | CCR2 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T89988 | chemokine (C-C motif) receptor 2 (CCR2) protein & antibody |
ORF Viral Vector | pGMLV000397 | Human CCR2 Lentivirus plasmid |
ORF Viral Vector | pGMLV000474 | Human CCR2 Lentivirus plasmid |
ORF Viral Vector | pGMLV001361 | Human CCR2 Lentivirus plasmid |
ORF Viral Vector | vGMLV000397 | Human CCR2 Lentivirus particle |
ORF Viral Vector | vGMLV000474 | Human CCR2 Lentivirus particle |
ORF Viral Vector | vGMLV001361 | Human CCR2 Lentivirus particle |
Target information
Target ID | GM-T89988 |
Target Name | CCR2 |
Gene ID | 729230, 12772, 574098, 539002 |
Gene Symbol and Synonyms | CC-CKR-2,CCR-2,CCR2,CCR2A,CCR2B,CD192,CKR2,CKR2A,CKR2B,CMKBR2,MCP-1-R,mJe-r |
Uniprot Accession | P41597 |
Uniprot Entry Name | CCR2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000121807 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The encoded protein mediates agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This protein can also be a coreceptor with CD4 for HIV-1 infection. This gene is located in the chemokine receptor gene cluster region of chromosome 3. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.