Human CCR2/CC-CKR-2/CCR-2 ORF/cDNA clone-Lentivirus plasmid (NM_001123041.2)

Cat. No.: pGMLV000397
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCR2/CC-CKR-2/CCR-2 Lentiviral expression plasmid for CCR2 lentivirus packaging, CCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CCR2/CC-CKR-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $615
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000397
Gene Name CCR2
Accession Number NM_001123041.2
Gene ID 729230
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1125 bp
Gene Alias CC-CKR-2,CCR-2,CCR2A,CCR2B,CD192,CKR2,CKR2A,CKR2B,CMKBR2,MCP-1-R
Fluorescent Reporter ZsGreen-Firefly luciferase
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGTCCACATCTCGTTCTCGGTTTATCAGAAATACCAACGAGAGCGGTGAAGAAGTCACCACCTTTTTTGATTATGATTACGGTGCTCCCTGTCATAAATTTGACGTGAAGCAAATTGGGGCCCAACTCCTGCCTCCGCTCTACTCGCTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCGTCCTCATCTTAATAAACTGCAAAAAGCTGAAGTGCTTGACTGACATTTACCTGCTCAACCTGGCCATCTCTGATCTGCTTTTTCTTATTACTCTCCCATTGTGGGCTCACTCTGCTGCAAATGAGTGGGTCTTTGGGAATGCAATGTGCAAATTATTCACAGGGCTGTATCACATCGGTTATTTTGGCGGAATCTTCTTCATCATCCTCCTGACAATCGATAGATACCTGGCTATTGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACCTGGTTGGTGGCTGTGTTTGCTTCTGTCCCAGGAATCATCTTTACTAAATGCCAGAAAGAAGATTCTGTTTATGTCTGTGGCCCTTATTTTCCACGAGGATGGAATAATTTCCACACAATAATGAGGAACATTTTGGGGCTGGTCCTGCCGCTGCTCATCATGGTCATCTGCTACTCGGGAATCCTGAAAACCCTGCTTCGGTGTCGAAACGAGAAGAAGAGGCATAGGGCAGTGAGAGTCATCTTCACCATCATGATTGTTTACTTTCTCTTCTGGACTCCCTATAATATTGTCATTCTCCTGAACACCTTCCAGGAATTCTTCGGCCTGAGTAACTGTGAAAGCACCAGTCAACTGGACCAAGCCACGCAGGTGACAGAGACTCTTGGGATGACTCACTGCTGCATCAATCCCATCATCTATGCCTTCGTTGGGGAGAAGTTCAGAAGCCTTTTTCACATAGCTCTTGGCTGTAGGATTGCCCCACTCCAAAAACCAGTGTGTGGAGGTCCAGGAGTGAGACCAGGAAAGAATGTGAAAGTGACTACACAAGGACTCCTCGATGGTCGTGGAAAAGGAAAGTCAATTGGCAGAGCCCCTGAAGCCAGTCTTCAGGACAAAGAAGGAGCCTAG
ORF Protein Sequence MLSTSRSRFIRNTNESGEEVTTFFDYDYGAPCHKFDVKQIGAQLLPPLYSLVFIFGFVGNMLVVLILINCKKLKCLTDIYLLNLAISDLLFLITLPLWAHSAANEWVFGNAMCKLFTGLYHIGYFGGIFFIILLTIDRYLAIVHAVFALKARTVTFGVVTSVITWLVAVFASVPGIIFTKCQKEDSVYVCGPYFPRGWNNFHTIMRNILGLVLPLLIMVICYSGILKTLLRCRNEKKRHRAVRVIFTIMIVYFLFWTPYNIVILLNTFQEFFGLSNCESTSQLDQATQVTETLGMTHCCINPIIYAFVGEKFRSLFHIALGCRIAPLQKPVCGGPGVRPGKNVKVTTQGLLDGRGKGKSIGRAPEASLQDKEGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-447 Pre-Made Plozalizumab biosimilar, Whole mAb, Anti-CCR2 Antibody: Anti-CKR2/CD192/CKR2A/CKR2B/CMKBR2/MCP-1-R/CC-CKR-2 therapeutic antibody
    Target Antibody GM-Tg-g-T89988-Ab Anti-CCR2/ CC-CKR-2/ CCR-2A monoclonal antibody
    Target Antigen GM-Tg-g-T89988-Ag CCR2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T89988 chemokine (C-C motif) receptor 2 (CCR2) protein & antibody
    ORF Viral Vector pGMLV000397 Human CCR2 Lentivirus plasmid
    ORF Viral Vector pGMLV000474 Human CCR2 Lentivirus plasmid
    ORF Viral Vector pGMLV001361 Human CCR2 Lentivirus plasmid
    ORF Viral Vector vGMLV000397 Human CCR2 Lentivirus particle
    ORF Viral Vector vGMLV000474 Human CCR2 Lentivirus particle
    ORF Viral Vector vGMLV001361 Human CCR2 Lentivirus particle


    Target information

    Target ID GM-T89988
    Target Name CCR2
    Gene ID 729230, 12772, 574098, 539002
    Gene Symbol and Synonyms CC-CKR-2,CCR-2,CCR2,CCR2A,CCR2B,CD192,CKR2,CKR2A,CKR2B,CMKBR2,MCP-1-R,mJe-r
    Uniprot Accession P41597
    Uniprot Entry Name CCR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000121807
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a receptor for monocyte chemoattractant protein-1, a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. The encoded protein mediates agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. This protein can also be a coreceptor with CD4 for HIV-1 infection. This gene is located in the chemokine receptor gene cluster region of chromosome 3. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.