Human MAPT/DDPAC/FTDP-17 ORF/cDNA clone-Lentivirus plasmid (NM_005910.5)

Cat. No.: pGMLV000202
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPT/DDPAC/FTDP-17 Lentiviral expression plasmid for MAPT lentivirus packaging, MAPT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MAPT/DDPAC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $671.28
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000202
Gene Name MAPT
Accession Number NM_005910.5
Gene ID 4137
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1326 bp
Gene Alias DDPAC,FTDP-17,MAPTL,MSTD,MTBT1,MTBT2,PPND,PPP1R103,TAU
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCTGGGACGTACGGGTTGGGGGACAGGAAAGATCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGAATCTCCCCTGCAGACCCCCACTGAGGACGGATCTGAGGAACCGGGCTCTGAAACCTCTGATGCTAAGAGCACTCCAACAGCGGAAGATGTGACAGCACCCTTAGTGGATGAGGGAGCTCCCGGCAAGCAGGCTGCCGCGCAGCCCCACACGGAGATCCCAGAAGGAACCACAGCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAAGACGAAGCTGCTGGTCACGTGACCCAAGCTCGCATGGTCAGTAAAAGCAAAGACGGGACTGGAAGCGATGACAAAAAAGCCAAGGGGGCTGATGGTAAAACGAAGATCGCCACACCGCGGGGAGCAGCCCCTCCAGGCCAGAAGGGCCAGGCCAACGCCACCAGGATTCCAGCAAAAACCCCGCCCGCTCCAAAGACACCACCCAGCTCTGGTGAACCTCCAAAATCAGGGGATCGCAGCGGCTACAGCAGCCCCGGCTCCCCAGGCACTCCCGGCAGCCGCTCCCGCACCCCGTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGTACTCCACCCAAGTCGCCGTCTTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGCCCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCACCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGTGTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCTAGCTGACGAGGTGTCTGCCTCCCTGGCCAAGCAGGGTTTGTGA
ORF Protein Sequence MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEDVTAPLVDEGAPGKQAAAQPHTEIPEGTTAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAPKTPPSSGEPPKSGDRSGYSSPGSPGTPGSRSRTPSLPTPPTREPKKVAVVRTPPKSPSSAKSRLQTAPVPMPDLKNVKSKIGSTENLKHQPGGGKVQIINKKLDLSNVQSKCGSKDNIKHVPGGGSVQIVYKPVDLSKVTSKCGSLGNIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGGNKKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSSTGSIDMVDSPQLATLADEVSASLAKQGL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-572 Pre-Made Tilavonemab biosimilar, Whole mAb, Anti-MAPT Antibody: Anti-DDPAC/FTDP-17/MSTD/MTBT1/MTBT2/PPND/PPP1R103/TAU/tau-40 therapeutic antibody
    Biosimilar GMP-Bios-ab-635 Pre-Made Zagotenemab biosimilar, Whole mAb, Anti-MAPT Antibody: Anti-DDPAC/FTDP-17/MSTD/MTBT1/MTBT2/PPND/PPP1R103/TAU/tau-40 therapeutic antibody
    Biosimilar GMP-Bios-ab-512 Pre-Made Semorinemab biosimilar, Whole mAb, Anti-MAPT Antibody: Anti-DDPAC/FTDP-17/MSTD/MTBT1/MTBT2/PPND/PPP1R103/TAU/tau-40 therapeutic antibody
    Biosimilar GMP-Bios-ab-061 Pre-Made Bepranemab biosimilar, Whole mAb, Anti-MAPT Antibody: Anti-DDPAC/FTDP-17/MSTD/MTBT1/MTBT2/PPND/PPP1R103/TAU/tau-40 therapeutic antibody
    Biosimilar GMP-Bios-ab-252 Pre-Made Gosuranemab biosimilar, Whole mAb, Anti-MAPT Antibody: Anti-DDPAC/FTDP-17/MSTD/MTBT1/MTBT2/PPND/PPP1R103/TAU/tau-40 therapeutic antibody
    Target Antibody GM-Tg-g-T45593-Ab Anti-TAU/ MAPT/ DDPAC monoclonal antibody
    Target Antigen GM-Tg-g-T45593-Ag MAPT VLP (virus-like particle)
    ORF Viral Vector pGMLV000202 Human MAPT Lentivirus plasmid
    ORF Viral Vector pGMAAV000031 Human MAPT Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC001846 Human MAPT Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000202 Human MAPT Lentivirus particle
    ORF Viral Vector vGMAAV000031 Human MAPT Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T45593
    Target Name MAPT
    Gene ID 4137, 17762, 574327, 29477, 101089557, 480488, 281296, 100054638
    Gene Symbol and Synonyms DDPAC,FTDP-17,MAPT,MAPTL,MAPT_0N4R,MSTD,Mtapt,MTBT1,MTBT2,PHF-tau,PPND,PPP1R103,pTau,RNPTAU,TAU,tau-40,Tau-PHF6
    Uniprot Accession P10636
    Uniprot Entry Name TAU_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker, INN Index
    Disease Breast Cancer
    Gene Ensembl ENSG00000186868
    Target Classification Not Available

    This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.