Human IL17C/CX2/IL-17C ORF/cDNA clone-Lentivirus plasmid (NM_013278)

SKU: pGMLP004492
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL17C/CX2/IL-17C Lentiviral expression plasmid for IL17C lentivirus packaging, IL17C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL17C/CX2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $448.5
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP004492
Gene Name IL17C
Accession Number NM_013278
Gene ID 27189
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 594 bp
Gene Alias CX2,IL-17C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACGCTCCTCCCCGGCCTCCTGTTTCTGACCTGGCTGCACACATGCCTGGCCCACCATGACCCCTCCCTCAGGGGGCACCCCCACAGTCACGGTACCCCACACTGCTACTCGGCTGAGGAACTGCCCCTCGGCCAGGCCCCCCCACACCTGCTGGCTCGAGGTGCCAAGTGGGGGCAGGCTTTGCCTGTAGCCCTGGTGTCCAGCCTGGAGGCAGCAAGCCACAGGGGGAGGCACGAGAGGCCCTCAGCTACGACCCAGTGCCCGGTGCTGCGGCCGGAGGAGGTGTTGGAGGCAGACACCCACCAGCGCTCCATCTCACCCTGGAGATACCGTGTGGACACGGATGAGGACCGCTATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAGGCTGTATCGATGCACGGACGGGCCGCGAGACAGCTGCGCTCAACTCCGTGCGGCTGCTCCAGAGCCTGCTGGTGCTGCGCCGCCGGCCCTGCTCCCGCGACGGCTCGGGGCTCCCCACACCTGGGGCCTTTGCCTTCCACACCGAGTTCATCCACGTCCCCGTCGGCTGCACCTGCGTGCTGCCCCGTTCAGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1022-Ab Anti-IL17C/ CX2/ IL-17C functional antibody
    Target Antigen GM-Tg-g-SE1022-Ag IL17C protein
    Cytokine cks-Tg-g-GM-SE1022 interleukin 17C (IL17C) protein & antibody
    ORF Viral Vector pGMLP004492 Human IL17C Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-022 Human IL17C Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-105 Human IL17C Adenovirus plasmid
    ORF Viral Vector vGMLP004492 Human IL17C Lentivirus particle
    ORF Viral Vector vGMLP-IL-022 Human IL17C Lentivirus particle
    ORF Viral Vector vGMAP-IL-105 Human IL17C Adenovirus particle


    Target information

    Target ID GM-SE1022
    Target Name IL17C
    Gene ID 27189, 234836, 710618, 691516, 101097443, 608988, 100050766
    Gene Symbol and Synonyms CX2,IL-17C,IL17C
    Uniprot Accession Q9P0M4
    Uniprot Entry Name IL17C_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000124391
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.