Human ALDH3A1/ALDH3/ ALDHIII ORF/cDNA clone-Lentivirus plasmid (NM_000691)
Pre-made Human ALDH3A1/ALDH3/ ALDHIII Lentiviral expression plasmid for ALDH3A1 lentivirus packaging, ALDH3A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to ALDH3A1/ALDH3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003163 | Human ALDH3A1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003163 |
Gene Name | ALDH3A1 |
Accession Number | NM_000691 |
Gene ID | 218 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1362 bp |
Gene Alias | ALDH3, ALDHIII |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCAAGATCAGCGAGGCCGTGAAGCGCGCCCGCGCCGCCTTCAGCTCGGGCAGGACCCGTCCGCTGCAGTTCCGGATCCAGCAGCTGGAGGCGCTGCAGCGCCTGATCCAGGAGCAGGAGCAGGAGCTGGTGGGCGCGCTGGCCGCAGACCTGCACAAGAATGAATGGAACGCCTACTATGAGGAGGTGGTGTACGTCCTAGAGGAGATCGAGTACATGATCCAGAAGCTCCCTGAGTGGGCCGCGGATGAGCCCGTGGAGAAGACGCCCCAGACTCAGCAGGACGAGCTCTACATCCACTCGGAGCCACTGGGCGTGGTCCTCGTCATTGGCACCTGGAACTACCCCTTCAACCTCACCATCCAGCCCATGGTGGGCGCCATCGCTGCAGGGAACTCAGTGGTCCTCAAGCCCTCGGAGCTGAGTGAGAACATGGCGAGCCTGCTGGCTACCATCATCCCCCAGTACCTGGACAAGGATCTGTACCCAGTAATCAATGGGGGTGTCCCTGAGACCACGGAGCTGCTCAAGGAGAGGTTCGACCATATCCTGTACACGGGCAGCACGGGGGTGGGGAAGATCATCATGACGGCTGCTGCCAAGCACCTGACCCCTGTCACGCTGGAGCTGGGAGGGAAGAGTCCCTGCTACGTGGACAAGAACTGTGACCTGGACGTGGCCTGCCGACGCATCGCCTGGGGGAAATTCATGAACAGTGGCCAGACCTGCGTGGCCCCTGACTACATCCTCTGTGACCCCTCGATCCAGAACCAAATTGTGGAGAAGCTCAAGAAGTCACTGAAAGAGTTCTACGGGGAAGATGCTAAGAAATCCCGGGACTATGGAAGAATCATTAGTGCCCGGCACTTCCAGAGGGTGATGGGCCTGATTGAGGGCCAGAAGGTGGCTTATGGGGGCACCGGGGATGCCGCCACTCGCTACATAGCCCCCACCATCCTCACGGACGTGGACCCCCAGTCCCCGGTGATGCAAGAGGAGATCTTCGGGCCTGTGCTGCCCATCGTGTGCGTGCGCAGCCTGGAGGAGGCCATCCAGTTCATCAACCAGCGTGAGAAGCCCCTGGCCCTCTACATGTTCTCCAGCAACGACAAGGTGATTAAGAAGATGATTGCAGAGACATCCAGTGGTGGGGTGGCGGCCAACGATGTCATCGTCCACATCACCTTGCACTCTCTGCCCTTCGGGGGCGTGGGGAACAGCGGCATGGGATCCTACCATGGCAAGAAGAGCTTCGAGACTTTCTCTCACCGCCGCTCTTGCCTGGTGAGGCCTCTGATGAATGATGAAGGCCTGAAGGTCAGATACCCCCCGAGCCCGGCCAAGATGACCCAGCACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1982-Ab | Anti-AL3A1/ ALDH3A1/ ALDH3 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1982-Ag | ALDH3A1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000478 | Human ALDH3A1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003163 | Human ALDH3A1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000478 | Human ALDH3A1 Lentivirus particle |
ORF Viral Vector | vGMLP003163 | Human ALDH3A1 Lentivirus particle |
Target information
Target ID | GM-MP1982 |
Target Name | ALDH3A1 |
Gene ID | 218, 11670, 703870, 25375, 101096364, 489526, 281617, 100073157 |
Gene Symbol and Synonyms | Ahd-4,Ahd-c,Ahd4,AHDC,Aldh,ALDH3,ALDH3A1,ALDHIII |
Uniprot Accession | P30838 |
Uniprot Entry Name | AL3A1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000108602 |
Target Classification | Not Available |
Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.