Human IL27/IL-27/IL-27A ORF/cDNA clone-Lentivirus plasmid (NM_145659)

Cat. No.: pGMLP002772
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL27/IL-27/IL-27A Lentiviral expression plasmid for IL27 lentivirus packaging, IL27 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL27/IL-27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $483
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002772
Gene Name IL27
Accession Number NM_145659
Gene ID 246778
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 732 bp
Gene Alias IL-27,IL-27A,IL27A,IL27p28,IL30,p28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCCAGACGGCAGGCGACCTTGGCTGGCGGCTCAGCCTGTTGCTGCTTCCCTTGCTCCTGGTTCAAGCTGGTGTCTGGGGATTCCCAAGGCCCCCAGGGAGGCCCCAGCTGAGCCTGCAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCGCTTTGCGGAATCTCACCTGCCAGGAGTGAACCTGTACCTCCTGCCCCTGGGAGAGCAGCTCCCTGATGTTTCCCTGACCTTCCAGGCCTGGCGCCGCCTCTCTGACCCGGAGCGTCTCTGCTTCATCTCCACCACGCTTCAGCCCTTCCATGCCCTGCTGGGAGGGCTGGGGACCCAGGGCCGCTGGACCAACATGGAGAGGATGCAGCTGTGGGCCATGAGGCTGGACCTCCGCGATCTGCAGCGGCACCTCCGCTTCCAGGTGCTGGCTGCAGGATTCAACCTCCCGGAGGAGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAGGAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCCCGGCCCAGGTGTCCTGGCCCCAGCTCCTCTCCACCTACCGCCTGCTGCACTCCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCAAGGCTGGGCACTCAGTCTGGCCCTTGGGGTTCCCAACATTGAGCCCCCAGCCCTGA
ORF Protein Sequence MGQTAGDLGWRLSLLLLPLLLVQAGVWGFPRPPGRPQLSLQELRREFTVSLHLARKLLSEVRGQAHRFAESHLPGVNLYLLPLGEQLPDVSLTFQAWRRLSDPERLCFISTTLQPFHALLGGLGTQGRWTNMERMQLWAMRLDLRDLQRHLRFQVLAAGFNLPEEEEEEEEEEEEERKGLLPGALGSALQGPAQVSWPQLLSTYRLLHSLELVLSRAVRELLLLSKAGHSVWPLGFPTLSPQP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1026-Ab Anti-IL27A/ IL27/ IL-27 functional antibody
    Target Antigen GM-Tg-g-SE1026-Ag IL27 protein
    ORF Viral Vector pGMLP002772 Human IL27 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-034 Human IL27 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-117 Human IL27 Adenovirus plasmid
    ORF Viral Vector vGMLP002772 Human IL27 Lentivirus particle
    ORF Viral Vector vGMLP-IL-034 Human IL27 Lentivirus particle
    ORF Viral Vector vGMAP-IL-117 Human IL27 Adenovirus particle


    Target information

    Target ID GM-SE1026
    Target Name IL27
    Gene ID 246778, 246779, 708678, 365368, 101093822, 607880, 614927, 100066317
    Gene Symbol and Synonyms IL-27,IL-27-A,IL-27A,IL-27alpha,IL-27p28,IL27,IL27-A,IL27A,IL27p28,IL30,p28,RGD1561420
    Uniprot Accession Q8NEV9
    Uniprot Entry Name IL27A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000197272
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.