Human CHRNA7/CHRNA7-2/NACHRA7 ORF/cDNA clone-Lentivirus plasmid (NM_000746)
Cat. No.: pGMLP001474
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CHRNA7/CHRNA7-2/NACHRA7 Lentiviral expression plasmid for CHRNA7 lentivirus packaging, CHRNA7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CHRNA7/CHRNA7-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001474 |
Gene Name | CHRNA7 |
Accession Number | NM_000746 |
Gene ID | 1139 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1509 bp |
Gene Alias | CHRNA7-2,NACHRA7 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCTGCTCGCCGGGAGGCGTCTGGCTGGCGCTGGCCGCGTCGCTCCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTACAAGGAGCTGGTCAAGAACTACAATCCCTTGGAGAGGCCCGTGGCCAATGACTCGCAACCACTCACCGTCTACTTCTCCCTGAGCCTCCTGCAGATCATGGACGTGGATGAGAAGAACCAAGTTTTAACCACCAACATTTGGCTGCAAATGTCTTGGACAGATCACTATTTACAGTGGAATGTGTCAGAATATCCAGGGGTGAAGACTGTTCGTTTCCCAGATGGCCAGATTTGGAAACCAGACATTCTTCTCTATAACAGTGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGAATTCTTCTGGGCATTGCCAGTACCTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCGATGTACGCTGGTTTCCCTTTGATGTGCAGCACTGCAAACTGAAGTTTGGGTCCTGGTCTTACGGAGGCTGGTCCTTGGATCTGCAGATGCAGGAGGCAGATATCAGTGGCTATATCCCCAATGGAGAATGGGACCTAGTGGGAATCCCCGGCAAGAGGAGTGAAAGGTTCTATGAGTGCTGCAAAGAGCCCTACCCCGATGTCACCTTCACAGTGACCATGCGCCGCAGGACGCTCTACTATGGCCTCAACCTGCTGATCCCCTGTGTGCTCATCTCCGCCCTCGCCCTGCTGGTGTTCCTGCTTCCTGCAGATTCCGGGGAGAAGATTTCCCTGGGGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCGCAACATCCGATTCGGTACCATTGATAGCCCAGTACTTCGCCAGCACCATGATCATCGTGGGCCTCTCGGTGGTGGTGACAGTGATCGTGCTGCAGTACCACCACCACGACCCCGACGGGGGCAAGATGCCCAAGTGGACCAGAGTCATCCTTCTGAACTGGTGCGCGTGGTTCCTGCGAATGAAGAGGCCCGGGGAGGACAAGGTGCGCCCGGCCTGCCAGCACAAGCAGCGGCGCTGCAGCCTGGCCAGTGTGGAGATGAGCGCCGTGGCGCCGCCGCCCGCCAGCAACGGGAACCTGCTGTACATCGGCTTCCGCGGCCTGGACGGCGTGCACTGTGTCCCGACCCCCGACTCTGGGGTAGTGTGTGGCCGCATGGCCTGCTCCCCCACGCACGATGAGCACCTCCTGCACGGCGGGCAACCCCCCGAGGGGGACCCGGACTTGGCCAAGATCCTGGAGGAGGTCCGCTACATTGCCAACCGCTTCCGCTGCCAGGACGAAAGCGAGGCGGTCTGCAGCGAGTGGAAGTTCGCCGCCTGTGTGGTGGACCGCCTGTGCCTCATGGCCTTCTCGGTCTTCACCATCATCTGCACCATCGGCATCCTGATGTCGGCTCCCAACTTCGTGGAGGCCGTGTCCAAAGACTTTGCGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T34429-Ab | Anti-ACHA7/ CHRNA7/ CHRNA7-2 monoclonal antibody |
Target Antigen | GM-Tg-g-T34429-Ag | CHRNA7 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001474 | Human CHRNA7 Lentivirus plasmid |
ORF Viral Vector | pGMPC000613 | Human CHRNA7 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC004791 | Human CHRNA7 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001474 | Human CHRNA7 Lentivirus particle |
Target information
Target ID | GM-T34429 |
Target Name | CHRNA7 |
Gene ID | 1139, 574230, 25302, 751113, 488696 |
Gene Symbol and Synonyms | BTX,CHRNA7,CHRNA7-2,NACHRA7,NARAD,nica7 |
Uniprot Accession | P36544 |
Uniprot Entry Name | ACHA7_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000175344 |
Target Classification | Ion Channel |
The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.