Human NQO1/DHQU/ DIA4 ORF/cDNA clone-Lentivirus plasmid (NM_000903)

Pre-made Human NQO1/DHQU/ DIA4 Lentiviral expression plasmid for NQO1 lentivirus packaging, NQO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to NQO1/DHQU products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000898 Human NQO1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000898
Gene Name NQO1
Accession Number NM_000903
Gene ID 1728
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 825 bp
Gene Alias DHQU, DIA4, DTD, NMOR1, NMORI, QR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCGGCAGAAGAGCACTGATCGTACTGGCTCACTCAGAGAGGACGTCCTTCAACTATGCCATGAAGGAGGCTGCTGCAGCGGCTTTGAAGAAGAAAGGATGGGAGGTGGTGGAGTCGGACCTCTATGCCATGAACTTCAATCCCATCATTTCCAGAAAGGACATCACAGGTAAACTGAAGGACCCTGCGAACTTTCAGTATCCTGCCGAGTCTGTTCTGGCTTATAAAGAAGGCCATCTGAGCCCAGATATTGTGGCTGAACAAAAGAAGCTGGAAGCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCCTCTTTGACCTAAACTTCCAGGCAGGATTCTTAATGAAAAAAGAGGTACAGGATGAGGAGAAAAACAAGAAATTTGGCCTTTCTGTGGGCCATCACTTGGGCAAGTCCATCCCAACTGACAACCAGATCAAAGCTAGAAAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T52389-Ab Anti-NQO1 monoclonal antibody
    Target Antigen GM-Tg-g-T52389-Ag NQO1 protein
    ORF Viral Vector pGMLV000811 Human NQO1 Lentivirus plasmid
    ORF Viral Vector pGMLP000898 Human NQO1 Lentivirus plasmid
    ORF Viral Vector vGMLV000811 Human NQO1 Lentivirus particle
    ORF Viral Vector vGMLP000898 Human NQO1 Lentivirus particle


    Target information

    Target ID GM-T52389
    Target Name NQO1
    Gene ID 1728, 18104, 705635, 24314, 101097859, 610935, 519632, 100067237
    Gene Symbol and Synonyms DHQU,DIA4,DTD,Nmo-1,Nmo1,NMOR1,NMORI,NQO1,Ox-1,Ox1,QR1
    Uniprot Accession P15559
    Uniprot Entry Name NQO1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000181019
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.