Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
Plasmid quantity:
- 10mg, 50mg, 100mg, 500mg, >1g
Talk to our Expert:
- • Research Grade
- • Endotoxin-Free Grade
- • High Quality (HQ) Grade
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human TNF/DIF/TNF-alpha ORF/cDNA clone-Adenovirus plasmid (BC028148)
Cat. No.: pGMAP000307
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TNF/DIF/TNF-alpha adenoviral expression plasmid for TNF adenovirus packaging, TNF adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
MSDS
Go to
TNF/DIF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000307 |
| Gene Name | TNF |
| Accession Number | BC028148 |
| Gene ID | 7124 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 702 bp |
| Gene Alias | DIF,TNF-alpha,TNFSF2 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| Sequence | ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATCGTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGAGATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T20178 |
| Target Name | TNF |
| Gene ID | 7124, 21926, 715467, 24835, 493755, 403922, 280943, 100033834 |
| Gene Symbol and Synonyms | cTNF,DIF,RATTNF,TNF,TNF-a,TNF-alpha,TNFA,TNFalpha,Tnfsf1a,TNFSF2,TNLG1F |
| Uniprot Accession | P01375 |
| Uniprot Entry Name | TNFA_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | Ovary Cancer, toluene diisocyanate asthma, Giant Cell Arteritis, Polymyalgia Rheumatica, Chronic Kidney Disease, Dent disease, Hodgkin's disease, Kidney transplant rejection, pancreatic cancer, Chronic Glomerulonephritis, Asthma |
| Gene Ensembl | ENSG00000232810 |
| Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis ankylosing spondylitis, tuberculosis, autosomal dominant polycystic kidney disease, and cancer. Mutations in this gene affect susceptibility to cerebral malaria, septic shock, and Alzheimer disease. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
