Human IL3/IL-3/MCGF ORF/cDNA clone-Adenovirus plasmid (BC069472)

SKU: pGMAP000287
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL3/IL-3/MCGF adenoviral expression plasmid for IL3 adenovirus packaging, IL3 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to IL3/IL-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000287
Gene Name IL3
Accession Number BC069472
Gene ID 3562
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 459 bp
Gene Alias IL-3,MCGF,MULTI-CSF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGAGCCGCCTGCCCGTCCTGCTCCTGCTCCAACTCCTGGTCCGCCCCGGACTCCAAGCTCCCATGACCCAGACAACGCCCTTGAAGACAAGCTGGGTTAACTGCTCTAACATGATCGATGAAATTATAACACACTTAAAGCAGCCACCTTTGCCTTTGCTGGACTTCAACAACCTCAATGGGGAAGACCAAGACATTCTGATGGAAAATAACCTTCGAAGGCCAAACCTGGAGGCATTCAACAGGGCTGTCAAGAGTTTACAGAACGCATCAGCAATTGAGAGCATTCTTAAAAATCTCCTGCCATGTCTGCCCCTGGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAGGACGGTGACTGGAATGAATTCCGGAGGAAACTGACGTTCTATCTGAAAACCCTTGAGAATGCGCAGGCTCAACAGACGACTTTGAGCCTCGCGATCTTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1027-Ab Anti-IL3/ IL-3/ MCGF functional antibody
    Target Antigen GM-Tg-g-SE1027-Ag IL3 protein
    ORF Viral Vector pGMLP000459 Human IL3 Lentivirus plasmid
    ORF Viral Vector pGMAP000287 Human IL3 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-006 Human IL3 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-089 Human IL3 Adenovirus plasmid
    ORF Viral Vector vGMLP000459 Human IL3 Lentivirus particle
    ORF Viral Vector vGMAP000287 Human IL3 Adenovirus particle
    ORF Viral Vector vGMLP-IL-006 Human IL3 Lentivirus particle
    ORF Viral Vector vGMAP-IL-089 Human IL3 Adenovirus particle


    Target information

    Target ID GM-SE1027
    Target Name IL3
    Gene ID 3562, 16187, 706946, 24495, 481497, 280823
    Gene Symbol and Synonyms BPA,Csfmu,HCGF,IL-3,IL3,MCGF,MULTI-CSF,PSF
    Uniprot Accession P08700
    Uniprot Entry Name IL3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000164399
    Target Classification Not Available

    The protein encoded by this gene is a potent growth promoting cytokine. This cytokine is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. This cytokine has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.