Human FTH1/FTH/ PIG15 ORF/cDNA clone-Adenovirus plasmid (BC000857)
Pre-made Human FTH1/FTH/ PIG15 adenoviral expression plasmid for FTH1 adenovirus packaging, FTH1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to FTH1/FTH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000151 | Human FTH1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000151 |
Gene Name | FTH1 |
Accession Number | BC000857 |
Gene ID | 2495 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 552 bp |
Gene Alias | FTH, PIG15, PLIF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89873-Ab | Anti-FTH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T89873-Ag | FTH1 protein |
ORF Viral Vector | pGMLV000307 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000308 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000822 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001052 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000151 | Human FTH1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000307 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMLV000308 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMAP000151 | Human FTH1 Adenovirus particle |
Target information
Target ID | GM-T89873 |
Target Name | FTH1 |
Gene ID | 2495, 14319, 574118, 25319, 654516, 403631, 281173, 100062811 |
Gene Symbol and Synonyms | FHC,FTH,FTH1,FTHL6,HFE5,HFt,LOC403631,MFH,PIG15,PLIF |
Uniprot Accession | P02794 |
Uniprot Entry Name | FRIH_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000167996 |
Target Classification | Not Available |
This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.