Human FTH1/FTH/PIG15 ORF/cDNA clone-Adenovirus plasmid (BC000857)

Cat. No.: pGMAP000151
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FTH1/FTH/PIG15 adenoviral expression plasmid for FTH1 adenovirus packaging, FTH1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to FTH1/FTH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000151
Gene Name FTH1
Accession Number BC000857
Gene ID 2495
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 552 bp
Gene Alias FTH,PIG15,PLIF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
ORF Nucleotide Sequence ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA
ORF Protein Sequence MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89873-Ab Anti-FTH1 monoclonal antibody
    Target Antigen GM-Tg-g-T89873-Ag FTH1 protein
    ORF Viral Vector pGMLV000307 Human FTH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000308 Human FTH1 Lentivirus plasmid
    ORF Viral Vector pGMAP000151 Human FTH1 Adenovirus plasmid
    ORF Viral Vector pGMPC000822 Human FTH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001052 Human FTH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000307 Human FTH1 Lentivirus particle
    ORF Viral Vector vGMLV000308 Human FTH1 Lentivirus particle
    ORF Viral Vector vGMAP000151 Human FTH1 Adenovirus particle


    Target information

    Target ID GM-T89873
    Target Name FTH1
    Gene ID 2495, 14319, 574118, 25319, 654516, 403631, 281173, 100062811
    Gene Symbol and Synonyms FHC,FTH,FTH1,FTHL6,HFE5,HFt,LOC403631,MFH,PIG15,PLIF
    Uniprot Accession P02794
    Uniprot Entry Name FRIH_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000167996
    Target Classification Not Available

    This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.