Human SOX2/ANOP3/ MCOPS3 ORF/cDNA clone-Adenovirus plasmid (NM_003106.4)
Pre-made Human SOX2/ANOP3/ MCOPS3 adenoviral expression plasmid for SOX2 adenovirus packaging, SOX2 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to SOX2/ANOP3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD000807 | Human SOX2 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD000807 |
Gene Name | SOX2 |
Accession Number | NM_003106.4 |
Gene ID | 6657 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 954 bp |
Gene Alias | ANOP3, MCOPS3 |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAGCCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGAAACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCCCGGCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGGGCGTGAACCAGCGCATGGACAGTTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAGCTGGGCTACCCGCAGCACCCGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTACGACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCTCCATGGGTTCGGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACATGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T00724-Ab | Anti-SOX2 monoclonal antibody |
Target Antigen | GM-Tg-g-T00724-Ag | SOX2 protein |
ORF Viral Vector | pGMLV000263 | Human SOX2 Lentivirus plasmid |
ORF Viral Vector | pGMLV000264 | Human SOX2 Lentivirus plasmid |
ORF Viral Vector | pGMAD000807 | Human SOX2 Adenovirus plasmid |
ORF Viral Vector | pGMPC000094 | Human SOX2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000433 | Human SOX2 Adenovirus plasmid |
ORF Viral Vector | vGMLV000263 | Human SOX2 Lentivirus particle |
ORF Viral Vector | vGMLV000264 | Human SOX2 Lentivirus particle |
ORF Viral Vector | vGMAD000807 | Human SOX2 Adenovirus particle |
ORF Viral Vector | vGMAP000433 | Human SOX2 Adenovirus particle |
Target information
Target ID | GM-T00724 |
Target Name | SOX2 |
Gene ID | 6657, 20674, 707039, 499593, 100379629, 488092, 784383, 100146979 |
Gene Symbol and Synonyms | ANOP3,lcc,MCOPS3,RGD1565646,Sox-2,SOX2,ysb |
Uniprot Accession | P48431 |
Uniprot Entry Name | SOX2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000181449 |
Target Classification | Not Available |
This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.