Human SOX2/ANOP3/ MCOPS3 ORF/cDNA clone-Adenovirus plasmid (NM_003106.4)

Pre-made Human SOX2/ANOP3/ MCOPS3 adenoviral expression plasmid for SOX2 adenovirus packaging, SOX2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to SOX2/ANOP3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000807 Human SOX2 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000807
Gene Name SOX2
Accession Number NM_003106.4
Gene ID 6657
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 954 bp
Gene Alias ANOP3, MCOPS3
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAGCCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGAAACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGGAGCACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCCCGGCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGGGCGTGAACCAGCGCATGGACAGTTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAGCTGGGCTACCCGCAGCACCCGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTACGACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCTCCATGGGTTCGGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCACTACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00724-Ab Anti-SOX2 monoclonal antibody
    Target Antigen GM-Tg-g-T00724-Ag SOX2 protein
    ORF Viral Vector pGMLV000263 Human SOX2 Lentivirus plasmid
    ORF Viral Vector pGMLV000264 Human SOX2 Lentivirus plasmid
    ORF Viral Vector pGMAD000807 Human SOX2 Adenovirus plasmid
    ORF Viral Vector pGMPC000094 Human SOX2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000433 Human SOX2 Adenovirus plasmid
    ORF Viral Vector vGMLV000263 Human SOX2 Lentivirus particle
    ORF Viral Vector vGMLV000264 Human SOX2 Lentivirus particle
    ORF Viral Vector vGMAD000807 Human SOX2 Adenovirus particle
    ORF Viral Vector vGMAP000433 Human SOX2 Adenovirus particle


    Target information

    Target ID GM-T00724
    Target Name SOX2
    Gene ID 6657, 20674, 707039, 499593, 100379629, 488092, 784383, 100146979
    Gene Symbol and Synonyms ANOP3,lcc,MCOPS3,RGD1565646,Sox-2,SOX2,ysb
    Uniprot Accession P48431
    Uniprot Entry Name SOX2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000181449
    Target Classification Not Available

    This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.