Human TGFB1/CED/DPD1 ORF/cDNA clone-Adenovirus plasmid (NM_000660)

Cat. No.: pGMAD000417
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TGFB1/CED/DPD1 adenoviral expression plasmid for TGFB1 adenovirus packaging, TGFB1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to TGFB1/CED products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000417
Gene Name TGFB1
Accession Number NM_000660
Gene ID 7040
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1173 bp
Gene Alias CED,DPD1,LAP,TGFB,TGFbeta
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCCAGCCCCCCGAGCCAGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTGTACAACAGCACCCGCGACCGGGTGGCCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTCACTACCGGCCGCCGAGGTGACCTGGCCACCATTCATGGCATGAACCGGCCTTTCCTGCTTCTCATGGCCACCCCGCTGGAGAGGGCCCAGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTGGACACCAACTATTGCTTCAGCTCCACGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATTGACTTCCGCAAGGACCTCGGCTGGAAGTGGATCCACGAGCCCAAGGGCTACCATGCCAACTTCTGCCTCGGGCCCTGCCCCTACATTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTGGCCCTGTACAACCAGCATAACCCGGGCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCGCTGGAGCCGCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAACATGATCGTGCGCTCCTGCAAGTGCAGCTGA
ORF Protein Sequence MPPSGLRLLPLLLPLLWLLVLTPGRPAAGLSTCKTIDMELVKRKRIEAIRGQILSKLRLASPPSQGEVPPGPLPEAVLALYNSTRDRVAGESAEPEPEPEADYYAKEVTRVLMVETHNEIYDKFKQSTHSIYMFFNTSELREAVPEPVLLSRAELRLLRLKLKVEQHVELYQKYSNNSWRYLSNRLLAPSDSPEWLSFDVTGVVRQWLSRGGEIEGFRLSAHCSCDSRDNTLQVDINGFTTGRRGDLATIHGMNRPFLLLMATPLERAQHLQSSRHRRALDTNYCFSSTEKNCCVRQLYIDFRKDLGWKWIHEPKGYHANFCLGPCPYIWSLDTQYSKVLALYNQHNPGASAAPCCVPQALEPLPIVYYVGRKPKVEQLSNMIVRSCKCS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-223 Pre-Made Fresolimumab biosimilar, Whole mAb, Anti-TGFB/TGFB1 Antibody: Anti-CED/DPD1/IBDIMDE/LAP therapeutic antibody
    Biosimilar GMP-Bios-INN-793 Pre-Made Dalutrafusp Alfa P Alfaiosimilar, Bispecific, Anti-NT5E/CD73;TGFB1;TGFB3 Antibody: Anti-eN/NTE/eNT/CALJA;CED/DPD1/IBDIMDE/LAP/TGF-beta1/TGFbeta;ARVD/ARVD1/LDS5/RNHF therapeutic antibody
    Biosimilar GMP-Bios-INN-908 Pre-Made Metelimumab Biosimilar, Whole Mab, Anti-Tgfb1 Antibody: Anti-CED/DPD1/IBDIMDE/LAP therapeutic antibody
    Target Antibody GM-Tg-g-T97257-Ab Anti-TGFB1/ CED/ DPD1 monoclonal antibody
    Target Antigen GM-Tg-g-T97257-Ag TGFB1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T97257 transforming growth factor, beta 1 (TGFB1) protein & antibody
    ORF Viral Vector pGMLP001905 Human TGFB1 Lentivirus plasmid
    ORF Viral Vector pGMAD000018 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMAD000417 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMAP000212 Human CED Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-037 Human TGFB1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-177 Human TGFB1 Adenovirus plasmid
    ORF Viral Vector pGMPC000678 Human TGFB1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001029 Human TGFB1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001905 Human TGFB1 Lentivirus particle
    ORF Viral Vector vGMAD000018 Human TGFB1 Adenovirus particle
    ORF Viral Vector vGMAD000417 Human TGFB1 Adenovirus particle
    ORF Viral Vector vGMAP000212 Human CED Adenovirus particle
    ORF Viral Vector vGMLP-SPh-037 Human TGFB1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-177 Human TGFB1 Adenovirus particle


    Target information

    Target ID GM-T97257
    Target Name TGFB1
    Gene ID 7040, 21803, 106992315, 59086, 768263, 403998, 282089, 100033900
    Gene Symbol and Synonyms CED,DPD1,IBDIMDE,LAP,TGF-beta,TGF-beta1,TGFB,Tgfb-1,TGFB1,TGFbeta,TGFbeta1
    Uniprot Accession P01137
    Uniprot Entry Name TGFB1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease bladder cancer, Chronic Kidney Disease, Diabetic Nephropathy, Type 2 diabetes mellitus, Type 1 diabetes mellitus, Sickle Cell Nephropathy, Renal tubulo-interstitial diseases, Malignant neoplasm of bladder, Lupus Glomerulonephritis, Kidney disease
    Gene Ensembl ENSG00000105329
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGFB family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.