Human BMI1/flvi-2/bmi-1/ FLVI2/BMI1 ORF/cDNA clone-Lentivirus particle (NM_005180)
Pre-made Human BMI1/flvi-2/bmi-1/ FLVI2/BMI1 Lentiviral expression plasmid for BMI1 lentivirus packaging, BMI1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BMI1/flvi-2/bmi-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001354 | Human BMI1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001354 |
Gene Name | BMI1 |
Accession Number | NM_005180 |
Gene ID | 648 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 981 bp |
Gene Alias | flvi-2/bmi-1, FLVI2/BMI1, PCGF4, RNF51 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCATCGAACAACGAGAATCAAGATCACTGAGCTAAATCCCCACCTGATGTGTGTGCTTTGTGGAGGGTACTTCATTGATGCCACAACCATAATAGAATGTCTACATTCCTTCTGTAAAACGTGTATTGTTCGTTACCTGGAGACCAGCAAGTATTGTCCTATTTGTGATGTCCAAGTTCACAAGACCAGACCACTACTGAATATAAGGTCAGATAAAACTCTCCAAGATATTGTATACAAATTAGTTCCAGGGCTTTTCAAAAATGAAATGAAGAGAAGAAGGGATTTTTATGCAGCTCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCACAGTTTCCTCACATTTCCAGTACTATGAATGGAACCAGCAACAGCCCCAGCGGTAACCACCAATCTTCTTTTGCCAATAGACCTCGAAAATCATCAGTAAATGGGTCATCAGCAACTTCTTCTGGTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T74066-Ab | Anti-BMI1 monoclonal antibody |
Target Antigen | GM-Tg-g-T74066-Ag | BMI1 protein |
ORF Viral Vector | pGMLV000219 | Human BMI1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001354 | Human BMI1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000219 | Human BMI1 Lentivirus particle |
ORF Viral Vector | vGMLV001354 | Human BMI1 Lentivirus particle |
Target information
Target ID | GM-T74066 |
Target Name | BMI1 |
Gene ID | 648, 12151, 106992288, 307151, 554342, 487097, 510666 |
Gene Symbol and Synonyms | Bmi-1,BMI1,flvi-2/bmi-1,FLVI2/BMI1,PCGF4,RNF51 |
Uniprot Accession | P35226 |
Uniprot Entry Name | BMI1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000168283 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.