Human SLC22A12/OAT4L/RST ORF/cDNA clone-Lentivirus particle (NM_144585.3)

SKU: vGMLV001278
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLC22A12/OAT4L/RST Lentiviral expression plasmid for SLC22A12 lentivirus packaging, SLC22A12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to URAT1/SLC22A12/OAT4L products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001278 Human SLC22A12 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001278
Gene Name SLC22A12
Accession Number NM_144585.3
Gene ID 116085
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1662 bp
Gene Alias OAT4L,RST,URAT1
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCATTTTCTGAACTCCTGGACCTCGTGGGTGGCCTGGGCAGGTTCCAGGTTCTCCAGACGATGGCTCTGATGGTCTCCATCATGTGGCTGTGTACCCAGAGCATGCTGGAGAACTTCTCGGCCGCCGTGCCCAGCCACCGCTGCTGGGCACCCCTCCTGGACAACAGCACGGCTCAGGCCAGCATCCTAGGGAGCTTGAGTCCTGAGGCCCTCCTGGCTATTTCCATCCCGCCGGGCCCCAACCAGAGGCCCCACCAGTGCCGCCGCTTCCGCCAGCCACAGTGGCAGCTCTTGGACCCCAATGCCACGGCCACCAGCTGGAGCGAGGCCGACACGGAGCCGTGTGTGGATGGCTGGGTCTATGACCGCAGCATCTTCACCTCCACAATCGTGGCCAAGTGGAACCTCGTGTGTGACTCTCATGCTCTGAAGCCCATGGCCCAGTCCATCTACCTGGCTGGGATTCTGGTGGGAGCTGCTGCGTGCGGCCCTGCCTCAGACAGGTTTGGGCGCAGGCTGGTGCTAACCTGGAGCTACCTTCAGATGGCTGTGATGGGTACGGCAGCTGCCTTCGCCCCTGCCTTCCCCGTGTACTGCCTGTTCCGCTTCCTGTTGGCCTTTGCCGTGGCAGGCGTCATGATGAACACGGGCACTCTCCTGATGGAGTGGACGGCGGCACGGGCCCGACCCTTGGTGATGACCTTGAACTCTCTGGGCTTCAGCTTCGGCCATGGCCTGACAGCTGCAGTGGCCTACGGTGTGCGGGACTGGACACTGCTGCAGCTGGTGGTCTCGGTCCCCTTCTTCCTCTGCTTTTTGTACTCCTGGTGGCTGGCAGAGTCGGCACGATGGCTCCTCACCACAGGCAGGCTGGATTGGGGCCTGCAGGAGCTGTGGAGGGTGGCTGCCATCAACGGAAAGGGGGCAGTGCAGGACACCCTGACCCCTGAGGTCTTGCTTTCAGCCATGCGGGAGGAGCTGAGCATGGGCCAGCCTCCTGCCAGCCTGGGCACCCTGCTCCGCATGCCCGGACTGCGCTTCCGGACCTGTATCTCCACGTTGTGCTGGTTCGCCTTTGGCTTCACCTTCTTCGGCCTGGCCCTGGACCTGCAGGCCCTGGGCAGCAACATCTTCCTGCTCCAAATGTTCATTGGTGTCGTGGACATCCCAGCCAAGATGGGCGCCCTGCTGCTGCTGAGCCACCTGGGCCGCCGCCCCACGCTGGCCGCATCCCTGTTGCTGGCAGGGCTCTGCATTCTGGCCAACACGCTGGTGCCCCACGAAATGGGGGCTCTGCGCTCAGCCTTGGCCGTGCTGGGGCTGGGCGGGGTGGGGGCTGCCTTCACCTGCATCACCATCTACAGCAGCGAGCTCTTCCCCACTGTGCTCAGGATGACGGCAGTGGGCTTGGGCCAGATGGCAGCCCGTGGAGGAGCCATCCTGGGGCCTCTGGTCCGGCTGCTGGGTGTCCATGGCCCCTGGCTGCCCTTGCTGGTGTATGGGACGGTGCCAGTGCTGAGTGGCCTGGCCGCACTGCTTCTGCCCGAGACCCAGAGCTTGCCGCTGCCCGACACCATCCAAGATGTGCAGAACCAGGCAGTAAAGAAGGCAACACATGGCACGCTGGGGAACTCTGTCCTAAAATCCACACAGTTTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86057-Ab Anti-S22AC/ URAT1/ SLC22A12 monoclonal antibody
    Target Antigen GM-Tg-g-T86057-Ag URAT1/SLC22A12 VLP (virus-like particle)
    ORF Viral Vector pGMLV000029 Human SLC22A12 Lentivirus plasmid
    ORF Viral Vector pGMLV001278 Human SLC22A12 Lentivirus plasmid
    ORF Viral Vector pGMLV001559 Human SLC22A12 Lentivirus plasmid
    ORF Viral Vector vGMLV000029 Human SLC22A12 Lentivirus particle
    ORF Viral Vector vGMLV001278 Human SLC22A12 Lentivirus particle
    ORF Viral Vector vGMLV001559 Human SLC22A12 Lentivirus particle


    Target information

    Target ID GM-T86057
    Target Name URAT1
    Gene ID 116085, 717530, 365398, 101100592, 483761, 100055832
    Gene Symbol and Synonyms hURAT1,OAT4L,RST,SLC22A12,Slc22al2,UAT,URAT1
    Uniprot Accession Q96S37
    Uniprot Entry Name S22AC_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000197891
    Target Classification Not Available

    The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.