Human PRKAA1/AMPK/ AMPKa1 ORF/cDNA clone-Lentivirus particle (NM_006251.5)
Pre-made Human PRKAA1/AMPK/ AMPKa1 Lentiviral expression plasmid for PRKAA1 lentivirus packaging, PRKAA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to PRKAA1/AMPK products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001150 | Human PRKAA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001150 |
Gene Name | PRKAA1 |
Accession Number | NM_006251.5 |
Gene ID | 5562 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1680 bp |
Gene Alias | AMPK, AMPKa1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCAGACTCAGTTCCTGGAGAAAGATGGCGACAGCCGAGAAGCAGAAACACGACGGGCGGGTGAAGATCGGCCACTACATTCTGGGTGACACGCTGGGGGTCGGCACCTTCGGCAAAGTGAAGGTTGGCAAACATGAATTGACTGGGCATAAAGTAGCTGTGAAGATACTCAATCGACAGAAGATTCGGAGCCTTGATGTGGTAGGAAAAATCCGCAGAGAAATTCAGAACCTCAAGCTTTTCAGGCATCCTCATATAATTAAACTGTACCAGGTCATCAGTACACCATCTGATATTTTCATGGTGATGGAATATGTCTCAGGAGGAGAGCTATTTGATTATATCTGTAAGAATGGAAGGCTGGATGAAAAAGAAAGTCGGCGTCTGTTCCAACAGATCCTTTCTGGTGTGGATTATTGTCACAGGCATATGGTGGTCCATAGAGATTTGAAACCTGAAAATGTCCTGCTTGATGCACACATGAATGCAAAGATAGCTGATTTTGGTCTTTCAAACATGATGTCAGATGGTGAATTTTTAAGAACAAGTTGTGGCTCACCCAACTATGCTGCACCAGAAGTAATTTCAGGAAGATTGTATGCAGGCCCAGAGGTAGATATATGGAGCAGTGGGGTTATTCTCTATGCTTTATTATGTGGAACCCTTCCATTTGATGATGACCATGTGCCAACTCTTTTTAAGAAGATATGTGATGGGATCTTCTATACCCCTCAATATTTAAATCCTTCTGTGATTAGCCTTTTGAAACATATGCTGCAGGTGGATCCCATGAAGAGGGCCACAATCAAAGATATCAGGGAACATGAATGGTTTAAACAGGACCTTCCAAAATATCTCTTTCCTGAGGATCCATCATATAGTTCAACCATGATTGATGATGAAGCCTTAAAAGAAGTATGTGAAAAGTTTGAGTGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGAATCCTGTGACAAGCACTTACTCCAAAATGAGTCTACAGTTATACCAAGTGGATAGTAGAACTTATCTACTGGATTTCCGTAGTATTGATGATGAAATTACAGAAGCCAAATCAGGGACTGCTACTCCACAGAGATCGGGATCAGTTAGCAACTATCGATCTTGCCAAAGGAGTGATTCAGATGCTGAGGCTCAAGGAAAATCCTCAGAAGTTTCTCTTACCTCATCTGTGACCTCACTTGACTCTTCTCCTGTTGACCTAACTCCAAGACCTGGAAGTCACACAATAGAATTTTTTGAGATGTGTGCAAATCTAATTAAAATTCTTGCACAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-TA017-Ab | Anti-PRKAA1 monoclonal antibody |
Target Antigen | GM-Tg-g-TA017-Ag | PRKAA1 protein |
ORF Viral Vector | pGMLV000515 | Human PRKAA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000577 | Human PRKAA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001150 | Human PRKAA1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000051 | Human PRKAA1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP-SPh-132 | Human PRKAA1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-272 | Human PRKAA1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000515 | Human PRKAA1 Lentivirus particle |
ORF Viral Vector | vGMLV000577 | Human PRKAA1 Lentivirus particle |
ORF Viral Vector | vGMLV001150 | Human PRKAA1 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-132 | Human PRKAA1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-272 | Human PRKAA1 Adenovirus particle |
Target information
Target ID | GM-TA017 |
Target Name | PRKAA1 |
Gene ID | 5562, 105787, 695558, 65248, 101095885, 479351, 540404, 100009710 |
Gene Symbol and Synonyms | AMPK,AMPK alpha 1,AMPKa1,AMPKalpha1,C130083N04Rik,PRKAA1 |
Uniprot Accession | Q13131 |
Uniprot Entry Name | AAPK1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000132356 |
Target Classification | Kinase |
The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.