Human HSPB1/CMT2F/ HEL-S-102 ORF/cDNA clone-Lentivirus particle (NM_001540.3)

Pre-made Human HSPB1/CMT2F/ HEL-S-102 Lentiviral expression plasmid for HSPB1 lentivirus packaging, HSPB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to HSP20/HSPB1/CMT2F products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001124 Human HSPB1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001124
Gene Name HSPB1
Accession Number NM_001540.3
Gene ID 3315
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 618 bp
Gene Alias CMT2F, HEL-S-102, HMN2B, HS.76067, Hsp25, HSP27, HSP28, SRP27
Fluorescent Reporter
Mammalian Cell Selection Neomycin/G418
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCCGCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T39921-Ab Anti-HSPB1/ HSP20/ CMT2F monoclonal antibody
    Target Antigen GM-Tg-g-T39921-Ag HSP20/HSPB1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000322 Human HSPB1 Lentivirus plasmid
    ORF Viral Vector pGMLV000837 Human HSPB1 Lentivirus plasmid
    ORF Viral Vector pGMLV001124 Human HSPB1 Lentivirus plasmid
    ORF Viral Vector vGMLV000322 Human HSPB1 Lentivirus particle
    ORF Viral Vector vGMLV000837 Human HSPB1 Lentivirus particle
    ORF Viral Vector vGMLV001124 Human HSPB1 Lentivirus particle


    Target information

    Target ID GM-T39921
    Target Name HSP20
    Gene ID 3315, 15507, 715615, 24471, 101084411, 403979, 516099, 100059763
    Gene Symbol and Synonyms 27kDa,CMT2F,HEL-S-102,HMN2B,HS.76067,Hsp25,HSP27,HSP28,HSPB1,SRP27
    Uniprot Accession P04792
    Uniprot Entry Name HSPB1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Prostate Cancer, Congenital occlusion of ureteropelvic junction, Renal clear cell carcinoma
    Gene Ensembl ENSG00000106211
    Target Classification Not Available

    This gene encodes a member of the small heat shock protein (HSP20) family of proteins. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other proteins. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.