Human HSPB1/CMT2F/ HEL-S-102 ORF/cDNA clone-Lentivirus particle (NM_001540.3)
Pre-made Human HSPB1/CMT2F/ HEL-S-102 Lentiviral expression plasmid for HSPB1 lentivirus packaging, HSPB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to HSP20/HSPB1/CMT2F products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001124 | Human HSPB1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001124 |
Gene Name | HSPB1 |
Accession Number | NM_001540.3 |
Gene ID | 3315 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 618 bp |
Gene Alias | CMT2F, HEL-S-102, HMN2B, HS.76067, Hsp25, HSP27, HSP28, SRP27 |
Fluorescent Reporter | |
Mammalian Cell Selection | Neomycin/G418 |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGCTGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGACCAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGGTTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCCGCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGCGCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCACACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T39921-Ab | Anti-HSPB1/ HSP20/ CMT2F monoclonal antibody |
Target Antigen | GM-Tg-g-T39921-Ag | HSP20/HSPB1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000322 | Human HSPB1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000837 | Human HSPB1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001124 | Human HSPB1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000322 | Human HSPB1 Lentivirus particle |
ORF Viral Vector | vGMLV000837 | Human HSPB1 Lentivirus particle |
ORF Viral Vector | vGMLV001124 | Human HSPB1 Lentivirus particle |
Target information
Target ID | GM-T39921 |
Target Name | HSP20 |
Gene ID | 3315, 15507, 715615, 24471, 101084411, 403979, 516099, 100059763 |
Gene Symbol and Synonyms | 27kDa,CMT2F,HEL-S-102,HMN2B,HS.76067,Hsp25,HSP27,HSP28,HSPB1,SRP27 |
Uniprot Accession | P04792 |
Uniprot Entry Name | HSPB1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer, Congenital occlusion of ureteropelvic junction, Renal clear cell carcinoma |
Gene Ensembl | ENSG00000106211 |
Target Classification | Not Available |
This gene encodes a member of the small heat shock protein (HSP20) family of proteins. In response to environmental stress, the encoded protein translocates from the cytoplasm to the nucleus and functions as a molecular chaperone that promotes the correct folding of other proteins. This protein plays an important role in the differentiation of a wide variety of cell types. Expression of this gene is correlated with poor clinical outcome in multiple human cancers, and the encoded protein may promote cancer cell proliferation and metastasis, while protecting cancer cells from apoptosis. Mutations in this gene have been identified in human patients with Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.