Human AKT1/AKT/CWS6 ORF/cDNA clone-Lentivirus particle (NM_005163.2)

Cat. No.: vGMLP005800

Pre-made Human AKT1/AKT/CWS6 Lentiviral expression plasmid for AKT1 lentivirus packaging, AKT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AKT1/AKT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005800 Human AKT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005800
Gene Name AKT1
Accession Number NM_005163.2
Gene ID 207
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1443 bp
Gene Alias AKT,CWS6,PKB,PKB-ALPHA,PRKBA,RAC,RAC-ALPHA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAGACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAGCGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGCCAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGGACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACAACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTCCGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAGCCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACTTTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATCCTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGCGTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCACGACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTCATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATCAAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTGCTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTACGAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTCATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTTTCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAGGAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAGGAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGTGTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCCTGA
ORF Protein Sequence MSDVAIVKEGWLHKRGEYIKTWRPRYFLLKNDGTFIGYKERPQDVDQREAPLNNFSVAQCQLMKTERPRPNTFIIRCLQWTTVIERTFHVETPEEREEWTTAIQTVADGLKKQEEEEMDFRSGSPSDNSGAEEMEVSLAKPKHRVTMNEFEYLKLLGKGTFGKVILVKEKATGRYYAMKILKKEVIVAKDEVAHTLTENRVLQNSRHPFLTALKYSFQTHDRLCFVMEYANGGELFFHLSRERVFSEDRARFYGAEIVSALDYLHSEKNVVYRDLKLENLMLDKDGHIKITDFGLCKEGIKDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHEKLFELILMEEIRFPRTLGPEAKSLLSGLLKKDPKQRLGGGSEDAKEIMQHRFFAGIVWQHVYEKKLSPPFKPQVTSETDTRYFDEEFTAQMITITPPDQDDSMECVDSERRPHFPQFSYSASGTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67619-Ab Anti-AKT1 monoclonal antibody
    Target Antigen GM-Tg-g-T67619-Ag AKT1 protein
    ORF Viral Vector pGMLP005423 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLP005606 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLP005800 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000222 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000429 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMLV001602 Human AKT1 Lentivirus plasmid
    ORF Viral Vector pGMAP000133 Human AKT1 Adenovirus plasmid
    ORF Viral Vector pGMPC000431 Human AKT1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005423 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLP005606 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLP005800 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV000222 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV000429 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMLV001602 Human AKT1 Lentivirus particle
    ORF Viral Vector vGMAP000133 Human AKT1 Adenovirus particle


    Target information

    Target ID GM-T67619
    Target Name AKT1
    Gene ID 207, 11651, 697747, 24185, 101087931, 490878, 280991, 100061130
    Gene Symbol and Synonyms AKT,AKT1,LTR-akt,PKB,PKB-ALPHA,PKB/Akt,PKBalpha,PRKBA,RAC,RAC-ALPHA
    Uniprot Accession P31749
    Uniprot Entry Name AKT1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Non-Small Cell Lung Cancer
    Gene Ensembl ENSG00000142208
    Target Classification Kinase

    This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Cowden syndrome 6, and breast, colorectal, and ovarian cancers. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.