Human WNT10A/OODD/SSPS ORF/cDNA clone-Lentivirus particle (NM_025216.2)

Cat. No.: vGMLP005565

Pre-made Human WNT10A/OODD/SSPS Lentiviral expression plasmid for WNT10A lentivirus packaging, WNT10A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to WNT10A/OODD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005565 Human WNT10A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005565
Gene Name WNT10A
Accession Number NM_025216.2
Gene ID 80326
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1254 bp
Gene Alias OODD,SSPS,STHAG4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCAGCGCCCACCCTCGCCCCTGGCTGCGGCTCCGACCCCAGCCCCAGCCGCGGCCAGCGCTCTGGGTGCTCCTGTTCTTCCTACTGCTGCTGGCTGCTGCCATGCCCAGGTCAGCACCCAATGACATTCTGGACCTCCGCCTCCCCCCGGAGCCCGTGCTCAATGCCAACACAGTGTGCCTAACATTGCCAGGCCTGAGCCGGCGGCAGATGGAGGTGTGTGTGCGTCACCCTGATGTGGCTGCCTCAGCCATACAGGGCATCCAGATCGCCATCCACGAATGCCAACACCAATTCAGGGACCAGCGCTGGAACTGCTCAAGCCTGGAGACTCGCAACAAGATCCCCTATGAGAGTCCCATCTTCAGCAGAGGTTTCCGAGAGAGCGCTTTTGCCTACGCCATCGCAGCAGCTGGCGTGGTGCACGCCGTGTCCAATGCGTGTGCCCTGGGCAAACTGAAGGCCTGTGGCTGTGATGCGTCCCGGCGAGGGGACGAGGAGGCCTTCCGTAGGAAGCTGCACCGCTTACAACTGGATGCACTGCAGCGTGGTAAGGGCCTGAGCCATGGGGTCCCGGAACACCCAGCCCTGCCCACAGCCAGCCCAGGCCTGCAGGACTCCTGGGAGTGGGGCGGCTGCAGCCCCGACATGGGCTTCGGGGAGCGCTTTTCTAAGGACTTTCTGGACTCCCGGGAGCCTCACAGAGACATCCACGCGAGAATGAGGCTTCACAACAACCGAGTTGGGAGGCAGGCAGTGATGGAGAACATGCGGCGGAAGTGCAAGTGCCACGGCACGTCAGGCAGCTGCCAGCTCAAGACGTGCTGGCAGGTGACGCCCGAGTTCCGCACCGTGGGGGCGCTGCTGCGCAGCCGCTTCCACCGCGCCACGCTCATCCGGCCGCACAACCGCAACGGCGGCCAGCTGGAGCCGGGCCCAGCGGGGGCACCCTCGCCGGCTCCGGGCGCTCCCGGGCCGCGCCGACGGGCCAGCCCCGCCGACCTGGTCTACTTCGAAAAGTCTCCCGACTTCTGCGAGCGCGAGCCGCGCCTGGACTCGGCGGGCACCGTGGGCCGCCTGTGCAACAAGAGCAGCGCCGGCTCGGATGGCTGCGGCAGCATGTGCTGCGGCCGCGGCCACAACATCCTGCGCCAGACGCGCAGCGAGCGCTGCCACTGCCGCTTCCACTGGTGCTGTTTCGTGGTCTGCGAAGAGTGCCGCATCACCGAGTGGGTCAGCGTCTGCAAGTGA
ORF Protein Sequence MGSAHPRPWLRLRPQPQPRPALWVLLFFLLLLAAAMPRSAPNDILDLRLPPEPVLNANTVCLTLPGLSRRQMEVCVRHPDVAASAIQGIQIAIHECQHQFRDQRWNCSSLETRNKIPYESPIFSRGFRESAFAYAIAAAGVVHAVSNACALGKLKACGCDASRRGDEEAFRRKLHRLQLDALQRGKGLSHGVPEHPALPTASPGLQDSWEWGGCSPDMGFGERFSKDFLDSREPHRDIHARMRLHNNRVGRQAVMENMRRKCKCHGTSGSCQLKTCWQVTPEFRTVGALLRSRFHRATLIRPHNRNGGQLEPGPAGAPSPAPGAPGPRRRASPADLVYFEKSPDFCEREPRLDSAGTVGRLCNKSSAGSDGCGSMCCGRGHNILRQTRSERCHCRFHWCCFVVCEECRITEWVSVCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0555-Ab Anti-WN10A/ WNT10A/ OODD functional antibody
    Target Antigen GM-Tg-g-SE0555-Ag WNT10A protein
    Cytokine cks-Tg-g-GM-SE0555 wingless-type MMTV integration site family, member 10A (WNT10A) protein & antibody
    ORF Viral Vector pGMLP003668 Human WNT10A Lentivirus plasmid
    ORF Viral Vector pGMLP005565 Human WNT10A Lentivirus plasmid
    ORF Viral Vector vGMLP003668 Human WNT10A Lentivirus particle
    ORF Viral Vector vGMLP005565 Human WNT10A Lentivirus particle


    Target information

    Target ID GM-SE0555
    Target Name WNT10A
    Gene ID 80326, 22409, 700692, 316527, 101092455, 488528, 537330, 111773843
    Gene Symbol and Synonyms ECTD16,OODD,SSPS,STHAG4,WNT10A
    Uniprot Accession Q9GZT5
    Uniprot Entry Name WN10A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000135925
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.