Human BCAP31/6C6-AG/ BAP31 ORF/cDNA clone-Lentivirus particle (NM_001139457)
Pre-made Human BCAP31/6C6-AG/ BAP31 Lentiviral expression plasmid for BCAP31 lentivirus packaging, BCAP31 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BCAP31/6C6-AG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004845 | Human BCAP31 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004845 |
Gene Name | BCAP31 |
Accession Number | NM_001139457 |
Gene ID | 10134 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 942 bp |
Gene Alias | 6C6-AG, BAP31, CDM, DDCH, DXS1357E |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTGCCGAGGCGTCCTCCTCTTGGTGCCCTGGCACTGCTCTTCCCGAAGAACGCCTTTCAGTTAAACGGGCGTCGGAAATCTCGGGCTTCCTGGGGCAGGGATCGTCGGGAGAGGCCGCTCTGGACGTGTTGACACACGTGCTGGAGGGGGCAGGAAACAAGCTCACATCTTCCTGTGGGAAACCTTCTAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCGGAGGTCTTTGTTGTGTTGCTTCTCTGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGACGGAGGCAAGTTGGATGTCGGGAATGCTGAGGTGAAGTTGGAGGAAGAGAACAGGAGCCTGAAGGCTGACCTGCAGAAGCTAAAGGACGAGCTGGCCAGCACTAAGCAAAAACTAGAGAAAGCTGAAAACCAGGTTCTGGCCATGCGGAAGCAGTCTGAGGGCCTCACCAAGGAGTACGACCGCTTGCTGGAGGAGCACGCAAAGCTGCAGGCTGCAGTAGATGGTCCCATGGACAAGAAGGAAGAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0414-Ab | Anti-BCAP31 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0414-Ag | BCAP31 protein |
ORF Viral Vector | pGMLV000207 | Human BCAP31 Lentivirus plasmid |
ORF Viral Vector | pGMLP004845 | Human BCAP31 Lentivirus plasmid |
ORF Viral Vector | vGMLV000207 | Human BCAP31 Lentivirus particle |
ORF Viral Vector | vGMLP004845 | Human BCAP31 Lentivirus particle |
Target information
Target ID | GM-IP0414 |
Target Name | BCAP31 |
Gene ID | 10134, 27061, 696663, 293852, 101081202, 481080, 533949, 100058834 |
Gene Symbol and Synonyms | 6C6-AG,BAP31,BCAP31,CDM,DDCH,DELXQ28,DXS1357E,MICRODELXq28 |
Uniprot Accession | P51572 |
Uniprot Entry Name | BAP31_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000185825 |
Target Classification | Not Available |
This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. [provided by RefSeq, Jan 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.