Human WNT9B/WNT14B/WNT15 ORF/cDNA clone-Lentivirus particle (NM_001320458)

Cat. No.: vGMLP004820

Pre-made Human WNT9B/WNT14B/WNT15 Lentiviral expression plasmid for WNT9B lentivirus packaging, WNT9B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to WNT9B/WNT14B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004820 Human WNT9B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004820
Gene Name WNT9B
Accession Number NM_001320458
Gene ID 7484
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 990 bp
Gene Alias WNT14B,WNT15
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCCCCCCGCCCGCGCTGGCCCTGGCCGGGCTCTGCCTGCTGGCGCTGCCCGCCGCCGCCGCCTCCTACTTCGGCCTGACCGGGCGGGAAGTCCTGACGCCCTTCCCAGGATTGGGCACTGCGGCAGCCCCGGCACAGGGCGGGGCCCACCTGAAGCAGTGTGACCTGCTGAAGCTGTCCCGGCGGCAGAAGCAGCTCTGCCGGAGGGAGCCCGGCCTGGCTGAGACCCTGAGGGATGCTGCGCACCTCGGCCTGCTTGAGTGCCAGTTTCAGTTCCGGCATGAGCGCTGGAACTGTAGCCTGGAGGGCAGGATGGGCCTGCTCAAGAGAGGCTTCAAAGAGACAGCTTTCCTGTACGCGGTGTCCTCTGCCGCCCTCACCCACACCCTGGCCCGGGCCTGCAGCGCTGGGCGCATGGAGCGCTGCACCTGTGATGACTCTCCGGGGCTGGAGAGCCGGCAGGCCTGGCAGTGGGGCGTGTGCGGTGACAACCTCAAGTACAGCACCAAGTTTCTGAGCAACTTCCTGGGGTCCAAGAGAGGAAACAAGGACCTGCGGGCACGGGCAGACGCCCACAATACCCACGTGGGCATCAAGGCTGTGAAGAGTGGCCTCAGGACCACGTGTAAGTGCCATGGCGTATCAGGCTCCTGTGCCGTGCGCACCTGCTGGAAGCAGCTCTCCCCGTTCCGTGAGACGGGCCAGGTGCTGAAACTGCGCTATGACTCGGCTGTCAAGGTGTCCAGTGCCACCAATGAGGCCTTGGGCCGCCTAGAGCTGTGGGCCCCTGCCAGGCAGGGCAGCCTCACCAAAGGCCTGGCCCCAAGGTCTGGGGACCTGGTGTACATGGAGGACTCACCCAGCTTCTGCCGGCCCAGCAAGTACTCACCTGGCACAGCAGGTTGGAGTGCAGTGGCAAGATCTCAGCTCATCACAACCTCCACCTCCCGGATTCAAGCGATTCTCCCGTCTCAGCTGCCTGAGTAA
ORF Protein Sequence MRPPPALALAGLCLLALPAAAASYFGLTGREVLTPFPGLGTAAAPAQGGAHLKQCDLLKLSRRQKQLCRREPGLAETLRDAAHLGLLECQFQFRHERWNCSLEGRMGLLKRGFKETAFLYAVSSAALTHTLARACSAGRMERCTCDDSPGLESRQAWQWGVCGDNLKYSTKFLSNFLGSKRGNKDLRARADAHNTHVGIKAVKSGLRTTCKCHGVSGSCAVRTCWKQLSPFRETGQVLKLRYDSAVKVSSATNEALGRLELWAPARQGSLTKGLAPRSGDLVYMEDSPSFCRPSKYSPGTAGWSAVARSQLITTSTSRIQAILPSQLPE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0560-Ab Anti-WNT9B/ WNT14B/ WNT15 functional antibody
    Target Antigen GM-Tg-g-SE0560-Ag WNT9B protein
    Cytokine cks-Tg-g-GM-SE0560 wingless-type MMTV integration site family, member 9B (WNT9B) protein & antibody
    ORF Viral Vector pGMLP004820 Human WNT9B Lentivirus plasmid
    ORF Viral Vector vGMLP004820 Human WNT9B Lentivirus particle


    Target information

    Target ID GM-SE0560
    Target Name WNT9B
    Gene ID 7484, 22412, 716877, 303586, 101080844, 490919, 541243, 100063730
    Gene Symbol and Synonyms clf,clf1,wnt-14b,wnt-15,WNT14B,WNT15,WNT9B
    Uniprot Accession O14905
    Uniprot Entry Name WNT9B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000158955
    Target Classification Not Available

    The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.