Human MGP/GIG36/MGLAP ORF/cDNA clone-Lentivirus particle (NM_001190839)

Cat. No.: vGMLP004798

Pre-made Human MGP/GIG36/MGLAP Lentiviral expression plasmid for MGP lentivirus packaging, MGP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MGP/GIG36 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004798 Human MGP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004798
Gene Name MGP
Accession Number NM_001190839
Gene ID 4256
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 387 bp
Gene Alias GIG36,MGLAP,NTI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAGCCTGATCCTTCTTGCCATCCTGGCCGCCTTAGCGGTAGTAACTTTGTGTTATGGAGAGTGGCAGAAAGAAGAAAACTTCGGCTTTGATATCGTTTCAGTTCTCTCTCTGAACTGGCATCGTGCCCAGGAATCACATGAAAGCATGGAATCTTATGAACTTAATCCCTTCATTAACAGGAGAAATGCAAATACCTTCATATCCCCTCAGCAGAGATGGAGAGCTAAAGTCCAAGAGAGGATCCGAGAACGCTCTAAGCCTGTCCACGAGCTCAATAGGGAAGCCTGTGATGACTACAGACTTTGCGAACGCTACGCCATGGTTTATGGATACAATGCTGCCTATAATCGCTACTTCAGGAAGCGCCGAGGGACCAAATGA
ORF Protein Sequence MKSLILLAILAALAVVTLCYGEWQKEENFGFDIVSVLSLNWHRAQESHESMESYELNPFINRRNANTFISPQQRWRAKVQERIRERSKPVHELNREACDDYRLCERYAMVYGYNAAYNRYFRKRRGTK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1099-Ab Anti-MGP/ GIG36/ MGLAP functional antibody
    Target Antigen GM-Tg-g-SE1099-Ag MGP protein
    ORF Viral Vector pGMLP004798 Human MGP Lentivirus plasmid
    ORF Viral Vector vGMLP004798 Human MGP Lentivirus particle


    Target information

    Target ID GM-SE1099
    Target Name MGP
    Gene ID 4256, 17313, 574116, 25333, 101096741, 100856382, 282660, 100063934
    Gene Symbol and Synonyms GIG36,MGLAP,MGP,NTI
    Uniprot Accession P08493
    Uniprot Entry Name MGP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000111341
    Target Classification Not Available

    This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. Carboxylation status of the encoded protein is associated with calcification of the vasculature in human patients with cardiovascular disease and calcification of the synovial membranes in osteoarthritis patients. Mutations in this gene cause Keutel syndrome in human patients, which is characterized by abnormal cartilage calcification, peripheral pulmonary stenosis and facial hypoplasia. [provided by RefSeq, Sep 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.