Human CCL23/CK-BETA-8/Ckb-8 ORF/cDNA clone-Lentivirus particle (NM_145898)

Cat. No.: vGMLP004762

Pre-made Human CCL23/CK-BETA-8/Ckb-8 Lentiviral expression plasmid for CCL23 lentivirus packaging, CCL23 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCL23/CK-BETA-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004762 Human CCL23 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004762
Gene Name CCL23
Accession Number NM_145898
Gene ID 6368
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 363 bp
Gene Alias CK-BETA-8,Ckb-8,Ckb-8-1,CKb8,hmrp-2a,MIP-3,MIP3,MPIF-1,SCYA23
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTACTGCCCTTGGATCCCAGGCCCGGGTCACAAAAGATGCAGAGACAGAGTTCATGATGTCAAAGCTTCCATTGGAAAATCCAGTACTTCTGGACAGATTCCATGCTACTAGTGCTGACTGCTGCATCTCCTACACCCCACGAAGCATCCCGTGTTCACTCCTGGAGAGTTACTTTGAAACGAACAGCGAGTGCTCCAAGCCGGGTGTCATCTTCCTCACCAAGAAGGGGCGACGTTTCTGTGCCAACCCCAGTGATAAGCAAGTTCAGGTTTGCATGAGAATGCTGAAGCTGGACACACGGATCAAGACCAGGAAGAATTGA
ORF Protein Sequence MKVSVAALSCLMLVTALGSQARVTKDAETEFMMSKLPLENPVLLDRFHATSADCCISYTPRSIPCSLLESYFETNSECSKPGVIFLTKKGRRFCANPSDKQVQVCMRMLKLDTRIKTRKN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23934-Ab Anti-CCL23/ CK-BETA-8/ CKb8 functional antibody
    Target Antigen GM-Tg-g-T23934-Ag CCL23 protein
    Cytokine cks-Tg-g-GM-T23934 chemokine (C-C motif) ligand 23 (CCL23) protein & antibody
    ORF Viral Vector pGMLP004762 Human CCL23 Lentivirus plasmid
    ORF Viral Vector vGMLP004762 Human CCL23 Lentivirus particle


    Target information

    Target ID GM-T23934
    Target Name CCL23
    Gene ID 6368
    Gene Symbol and Synonyms CCL23,CK-BETA-8,Ckb-8,Ckb-8-1,CKb8,hmrp-2a,MIP-3,MIP3,MPIF-1,SCYA23
    Uniprot Accession P55773
    Uniprot Entry Name CCL23_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000274736
    Target Classification Not Available

    This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity on resting T lymphocytes and monocytes, lower activity on neutrophils and no activity on activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. In addition, the product of this gene is a potent agonist of the chemokine (C-C motif) receptor 1. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.