Human NPW/L8/L8C ORF/cDNA clone-Lentivirus particle (NM_001099456)

Cat. No.: vGMLP004560

Pre-made Human NPW/L8/L8C Lentiviral expression plasmid for NPW lentivirus packaging, NPW lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NPW/L8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004560 Human NPW Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004560
Gene Name NPW
Accession Number NM_001099456
Gene ID 283869
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 498 bp
Gene Alias L8,L8C,PPL8,PPNPW
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence CTGGCGTGGCGCCCAGGGGAGCGGGGGGCTCCCGCGAGCCGGCCGCGGCTGGCACTGCTGCTGCTTCTGCTCCTGCTGCCGCTGCCCTCCGGCGCGTGGTACAAGCACGTGGCGAGTCCCCGCTACCACACGGTGGGCCGCGCCGCTGGCCTGCTCATGGGGCTGCGTCGCTCACCCTATCTGTGGCGCCGCGCGCTGCGCGCGGCCGCCGGGCCCCTGGCCAGGGACACCCTCTCCCCCGAACCCGCAGCCCGCGAGGCTCCTCTCCTGCTGCCCTCGTGGGTTCAGGAGCTGTGGGAGACGCGACGCAGGAGCTCCCAGGCAGGGATCCCCGTCCGTGCGCCCCGGAGCCCGCGCGCCCCAGAGCCTGCGCTGGAACCGGAGTCCCTGGACTTCAGCGGAGCTGGCCAGAGACTTCGGAGAGACGTCTCCCGCCCAGCGGTGGACCCCGCAGCAAACCGCCTTGGCCTGCCCTGCCTGGCCCCCGGACCGTTCTGA
ORF Protein Sequence MAWRPGERGAPASRPRLALLLLLLLLPLPSGAWYKHVASPRYHTVGRAAGLLMGLRRSPYLWRRALRAAAGPLARDTLSPEPAAREAPLLLPSWVQELWETRRRSSQAGIPVRAPRSPRAPEPALEPESLDFSGAGQRLRRDVSRPAVDPAANRLGLPCLAPGPF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1136-Ab Anti-NPW/ L8/ L8C functional antibody
    Target Antigen GM-Tg-g-SE1136-Ag NPW protein
    ORF Viral Vector pGMLP004560 Human NPW Lentivirus plasmid
    ORF Viral Vector vGMLP004560 Human NPW Lentivirus particle


    Target information

    Target ID GM-SE1136
    Target Name NPW
    Gene ID 283869, 381073, 694262, 259224, 102902485, 111097554, 112444354, 100629171
    Gene Symbol and Synonyms Gm935,L8,L8C,NPW,PPL8,PPNPW
    Uniprot Accession Q8N729
    Uniprot Entry Name NPW_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183971
    Target Classification Not Available

    The product of this gene is processed into 23- and 30-amino acid neuropeptides that bind and activate two G-protein coupled receptors in the central nervous system. The neuropeptides have been shown to enhance cortisol secretion from adrenal cells through the adenylate cyclase/protein kinase A signaling cascade. The preproprotein is translated using a non-AUG initiation codon that is inferred from analyses of the mouse ortholog. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.