Human MC3R/BMIQ9/ MC3 ORF/cDNA clone-Lentivirus particle (NM_019888)

Pre-made Human MC3R/BMIQ9/ MC3 Lentiviral expression plasmid for MC3R lentivirus packaging, MC3R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MC3R/BMIQ9 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004498 Human MC3R Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004498
Gene Name MC3R
Accession Number NM_019888
Gene ID 4159
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 972 bp
Gene Alias BMIQ9, MC3, MC3-R, OB20, OQTL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCCAAGCCCCTTTCTTCAGCAACCAGAGCAGCAGCGCCTTCTGTGAGCAGGTCTTCATCAAGCCCGAGGTTTTCCTGTCTCTGGGCATCGTCAGTCTGCTGGAAAACATCCTGGTTATCCTGGCCGTGGTCAGGAACGGCAACCTGCACTCCCCGATGTACTTCTTTCTCTGCAGCCTGGCGGTGGCCGACATGCTGGTAAGTGTGTCCAATGCCCTGGAGACCATCATGATCGCCATCGTCCACAGCGACTACCTGACCTTCGAGGACCAGTTTATCCAGCACATGGACAACATCTTCGACTCCATGATCTGCATCTCCCTGGTGGCCTCCATCTGCAACCTCCTGGCCATCGCCGTCGACAGGTACGTCACCATCTTTTACGCGCTCCGCTACCACAGCATCATGACCGTGAGGAAGGCCCTCACCTTGATCGTGGCCATCTGGGTCTGCTGCGGCGTCTGTGGCGTGGTGTTCATCGTCTACTCGGAGAGCAAAATGGTCATTGTGTGCCTCATCACCATGTTCTTCGCCATGATGCTCCTCATGGGCACCCTCTACGTGCACATGTTCCTCTTTGCGCGGCTGCACGTCAAGCGCATAGCAGCACTGCCACCTGCCGACGGGGTGGCCCCACAGCAACACTCATGCATGAAGGGGGCAGTCACCATCACCATTCTCCTGGGCGTGTTCATCTTCTGCTGGGCCCCCTTCTTCCTCCACCTGGTCCTCATCATCACCTGCCCCACCAACCCCTACTGCATCTGCTACACTGCCCACTTCAACACCTACCTGGTCCTCATCATGTGCAACTCCGTCATCGACCCACTCATCTACGCTTTCCGGAGCCTGGAATTGCGCAACACCTTTAGGGAGATTCTCTGTGGCTGCAACGGCATGAACTTGGGATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T76846-Ab Anti-MC3R/ BMIQ9/ MC3 monoclonal antibody
    Target Antigen GM-Tg-g-T76846-Ag MC3R VLP (virus-like particle)
    ORF Viral Vector pGMLP004498 Human MC3R Lentivirus plasmid
    ORF Viral Vector vGMLP004498 Human MC3R Lentivirus particle


    Target information

    Target ID GM-T76846
    Target Name MC3R
    Gene ID 4159, 17201, 698439, 29310, 101091434, 485938, 505405, 100054477
    Gene Symbol and Synonyms BMIQ9,MC3,MC3-R,MC3R,OB20,OQTL
    Uniprot Accession P41968
    Uniprot Entry Name MC3R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000124089
    Target Classification GPCR

    This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.