Human MC3R/BMIQ9/MC3 ORF/cDNA clone-Lentivirus particle (NM_019888)
SKU: vGMLP004498
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MC3R/BMIQ9/MC3 Lentiviral expression plasmid for MC3R lentivirus packaging, MC3R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MC3R/BMIQ9 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004498 | Human MC3R Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004498 |
Gene Name | MC3R |
Accession Number | NM_019888 |
Gene ID | 4159 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 972 bp |
Gene Alias | BMIQ9,MC3,MC3-R,OB20,OQTL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCCAAGCCCCTTTCTTCAGCAACCAGAGCAGCAGCGCCTTCTGTGAGCAGGTCTTCATCAAGCCCGAGGTTTTCCTGTCTCTGGGCATCGTCAGTCTGCTGGAAAACATCCTGGTTATCCTGGCCGTGGTCAGGAACGGCAACCTGCACTCCCCGATGTACTTCTTTCTCTGCAGCCTGGCGGTGGCCGACATGCTGGTAAGTGTGTCCAATGCCCTGGAGACCATCATGATCGCCATCGTCCACAGCGACTACCTGACCTTCGAGGACCAGTTTATCCAGCACATGGACAACATCTTCGACTCCATGATCTGCATCTCCCTGGTGGCCTCCATCTGCAACCTCCTGGCCATCGCCGTCGACAGGTACGTCACCATCTTTTACGCGCTCCGCTACCACAGCATCATGACCGTGAGGAAGGCCCTCACCTTGATCGTGGCCATCTGGGTCTGCTGCGGCGTCTGTGGCGTGGTGTTCATCGTCTACTCGGAGAGCAAAATGGTCATTGTGTGCCTCATCACCATGTTCTTCGCCATGATGCTCCTCATGGGCACCCTCTACGTGCACATGTTCCTCTTTGCGCGGCTGCACGTCAAGCGCATAGCAGCACTGCCACCTGCCGACGGGGTGGCCCCACAGCAACACTCATGCATGAAGGGGGCAGTCACCATCACCATTCTCCTGGGCGTGTTCATCTTCTGCTGGGCCCCCTTCTTCCTCCACCTGGTCCTCATCATCACCTGCCCCACCAACCCCTACTGCATCTGCTACACTGCCCACTTCAACACCTACCTGGTCCTCATCATGTGCAACTCCGTCATCGACCCACTCATCTACGCTTTCCGGAGCCTGGAATTGCGCAACACCTTTAGGGAGATTCTCTGTGGCTGCAACGGCATGAACTTGGGATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T76846-Ab | Anti-MC3R/ BMIQ9/ MC3 monoclonal antibody |
Target Antigen | GM-Tg-g-T76846-Ag | MC3R VLP (virus-like particle) |
ORF Viral Vector | pGMLP004498 | Human MC3R Lentivirus plasmid |
ORF Viral Vector | vGMLP004498 | Human MC3R Lentivirus particle |
Target information
Target ID | GM-T76846 |
Target Name | MC3R |
Gene ID | 4159, 17201, 698439, 29310, 101091434, 485938, 505405, 100054477 |
Gene Symbol and Synonyms | BMIQ9,MC3,MC3-R,MC3R,OB20,OQTL |
Uniprot Accession | P41968 |
Uniprot Entry Name | MC3R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000124089 |
Target Classification | GPCR |
This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.