Human RAB9A/RAB9 ORF/cDNA clone-Lentivirus particle (NM_001195328)

Cat. No.: vGMLP004170

Pre-made Human RAB9A/RAB9 Lentiviral expression plasmid for RAB9A lentivirus packaging, RAB9A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RAB9A/RAB9 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004170 Human RAB9A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004170
Gene Name RAB9A
Accession Number NM_001195328
Gene ID 9367
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 606 bp
Gene Alias RAB9
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGGAAAATCATCACTTTTTAAAGTAATTCTCCTTGGAGATGGTGGAGTTGGGAAGAGTTCACTTATGAACAGATATGTAACTAATAAGTTTGATACCCAGCTCTTCCATACAATAGGTGTGGAATTTTTAAATAAAGATTTGGAAGTGGATGGACATTTTGTTACCATGCAGATTTGGGACACGGCAGGTCAGGAGCGATTCCGAAGCCTGAGGACACCATTTTACAGAGGTTCTGACTGCTGCCTGCTTACTTTTAGTGTCGATGATTCACAAAGCTTCCAGAACTTAAGTAACTGGAAGAAAGAATTCATATATTATGCAGATGTGAAAGAGCCTGAGAGCTTTCCTTTTGTGATTCTGGGTAACAAGATTGACATAAGCGAACGGCAGGTGTCTACAGAAGAAGCCCAAGCTTGGTGCAGGGACAACGGCGACTATCCTTATTTTGAAACAAGTGCAAAAGATGCCACAAATGTGGCAGCAGCCTTTGAGGAAGCGGTTCGAAGAGTTCTTGCTACCGAGGATAGGTCAGATCATTTGATTCAGACAGACACAGTCAATCTTCACCGAAAGCCCAAGCCTAGCTCATCTTGCTGTTGA
ORF Protein Sequence MAGKSSLFKVILLGDGGVGKSSLMNRYVTNKFDTQLFHTIGVEFLNKDLEVDGHFVTMQIWDTAGQERFRSLRTPFYRGSDCCLLTFSVDDSQSFQNLSNWKKEFIYYADVKEPESFPFVILGNKIDISERQVSTEEAQAWCRDNGDYPYFETSAKDATNVAAAFEEAVRRVLATEDRSDHLIQTDTVNLHRKPKPSSSCC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T66350-Ab Anti-RAB9A monoclonal antibody
    Target Antigen GM-Tg-g-T66350-Ag RAB9A protein
    ORF Viral Vector pGMLP004170 Human RAB9A Lentivirus plasmid
    ORF Viral Vector vGMLP004170 Human RAB9A Lentivirus particle


    Target information

    Target ID GM-T66350
    Target Name RAB9A
    Gene ID 9367, 56382, 720906, 84589, 101089079, 403947, 511776, 100050487
    Gene Symbol and Synonyms 2410064E05Rik,RAB9,RAB9A,Sid6061p
    Uniprot Accession P51151
    Uniprot Entry Name RAB9A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000123595
    Target Classification Not Available

    Enables GDP binding activity; GTP binding activity; and GTPase activity. Involved in negative regulation by host of symbiont catalytic activity; positive regulation of exocytosis; and regulation of protein localization. Located in late endosome; lysosome; and phagocytic vesicle. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.