Human VASH2 ORF/cDNA clone-Lentivirus particle (NM_001301056)

Pre-made Human VASH2/ Lentiviral expression plasmid for VASH2 lentivirus packaging, VASH2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to VASH2/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004153 Human VASH2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004153
Gene Name VASH2
Accession Number NM_001301056
Gene ID 79805
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1068 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCGGCTCCGCGGCCGACACTCACCGCTGCCCCCACCCCAAAGGCGCCAAAGGCACCCGGTCCCGGAGCAGCCACGCGCGGCCCGTGAGCCTCGCCACCAGCGGGGGCTCAGAGGAGGAGGACAAAGACGGCGGGGTGCTGTTCCACGTCAACAAGAGCGGCTTCCCCATCGACAGCCACACCTGGGAGCGCATGTGGATGCACGTGGCCAAGGTGCACCCTAAGGGGGGAGAAATGGTGGGCGCCATCAGGAACGCCGCCTTCTTGGCAAAGCCTTCAATACCCCAGGTCCCAAACTACAGGCTGTCGATGACGATCCCAGACTGGCTCCAGGCGATCCAGAATTACATGAAGACCCTACAATATAATCACACAGGGACCCAGTTCTTTGAAATTAGGAAAATGAGACCGCTGAGTGGGTTAATGGAAACAGCAAAAGAAATGACCCGAGAGTCCTTGCCTATCAAATGCCTTGAAGCTGTCATCCTGGGCATCTACTTAACCAATGGGCAGCCTTCCATTGAGCGGTTCCCCATCAGCTTTAAAACCTACTTCTCAGGAAACTACTTTCACCACGTTGTGCTGGGGATTTACTGCAATGGCCGCTATGGCTCATTGGGCATGAGCCGCAGGGCTGAGCTGATGGACAAGCCATTGACTTTTCGGACTCTGAGTGACCTCATCTTTGACTTTGAGGACTCTTACAAGAAATACCTGCACACAGTCAAGAAGGTCAAGATTGGGCTGTACGTCCCCCATGAGCCTCATAGCTTCCAGCCCATTGAGTGGAAGCAGCTGGTCCTCAACGTCTCAAAGATGCTGAGGGCTGACATAAGGAAGGAGCTGGAGAAATATGCCAGGGACATGAGAATGAAGATCCTGAAACCTGCAAGTGCCCACTCTCCGACCCAAGTGAGAAGCCGGGGAAAATCCCTGTCCCCCAGAAGGAGACAGGCAAGCCCCCCGAGGAGGCTCGGCCGGCGAGAGAAGTCGCCTGCACTGCCTGAAAAGAAGGTGGCTGATCTGAGCACTCTGAATGAAGTGGGCTATCAAATCCGAATTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1360-Ab Anti-VASH2 functional antibody
    Target Antigen GM-Tg-g-SE1360-Ag VASH2 protein
    ORF Viral Vector pGMLV000627 Human VASH2 Lentivirus plasmid
    ORF Viral Vector pGMLV001961 Human VASH2 Lentivirus plasmid
    ORF Viral Vector pGMLP004153 Human VASH2 Lentivirus plasmid
    ORF Viral Vector vGMLV000627 Human VASH2 Lentivirus particle
    ORF Viral Vector vGMLV001961 Human VASH2 Lentivirus particle
    ORF Viral Vector vGMLP004153 Human VASH2 Lentivirus particle


    Target information

    Target ID GM-SE1360
    Target Name VASH2
    Gene ID 79805, 226841, 709924, 498309, 101098109, 608015, 539085, 100053514
    Gene Symbol and Synonyms B130052G07Rik,RGD1564105,VASH2
    Uniprot Accession Q86V25
    Uniprot Entry Name VASH2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000143494
    Target Classification Not Available

    Enables actin binding activity; metallocarboxypeptidase activity; and microtubule binding activity. Involved in axon development and proteolysis. Acts upstream of or within cell-cell fusion; positive regulation of angiogenesis; and positive regulation of endothelial cell proliferation. Located in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.