Human GABRD/MGC45284 ORF/cDNA clone-Lentivirus particle (BC033801)

Cat. No.: vGMLP004093

Pre-made Human GABRD/MGC45284 Lentiviral expression plasmid for GABRD lentivirus packaging, GABRD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GABRD/MGC45284 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004093 Human GABRD Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004093
Gene Name GABRD
Accession Number BC033801
Gene ID 2563
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1359 bp
Gene Alias MGC45284
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACGCGCCCGCCCGGCTGCTGGCCCCGCTCCTGCTCCTCTGCGCGCAGCAGCTCCGCGGCACCAGAGCGATGAATGACATCGGCGACTACGTGGGCTCCAACCTGGAGATCTCCTGGCTCCCCAACCTGGACGGGCTGATAGCCGGCTACGCCCGCAACTTCCGGCCTGGCATCGGAGGCCCCCCCGTGAATGTGGCCCTTGCCCTGGAGGTGGCCAGCATCGACCACATCTCAGAGGCCAACATGGAGTACACCATGACGGTGTTCCTGCACCAGAGCTGGCGGGACAGCAGGCTCTCCTACAACCACACCAACGAGACCCTGGGCCTGGACAGCCGCTTCGTGGACAAGCTGTGGCTGCCCGACACCTTCATCGTGAACGCCAAGTCGGCCTGGTTCCACGACGTGACGGTGGAGAACAAGCTCATCCGGCTGCAGCCCGACGGCGTGATCCTGTACAGCATCCGAATCACCTCCACTGTGGCCTGCGACATGGACCTGGCCAAATACCCCATGGACGAGCAGGAGTGCATGCTGGACCTGGAGAGCTACGGTTACTCATCGGAGGACATCGTCTACTACTGGTCGGAGAGCCAGGAGCACATCCACGGGCTGGACAAGCTGCAGCTGGCGCAGTTCACCATCACCAGCTACCGCTTCACCACGGAGCTGATGAACTTCAAGTCCGCTGGCCAGTTCCCACGGCTCAGCCTGCACTTCCACCTGCGGAGGAACCGCGGCGTGTACATCATCCAATCCTACATGCCCTCCGTCCTGCTGGTCGCCATGTCCTGGGTCTCCTTCTGGATCAGCCAGGCGGCGGTGCCCGCCAGGGTGTCTCTAGGCATCACCACGGTGCTGACGATGACCACGCTCATGGTCAGTGCCCGCTCCTCCCTGCCACGGGCATCAGCCATCAAGGCACTGGACGTCTACTTCTGGATCTGCTATGTCTTCGTGTTTGCCGCCCTGGTGGAGTACGCCTTTGCTCATTTCAACGCCGACTACAGGAAGAAGCAGAAGGCCAAGGTCAAGGTCTCCAGGCCGAGGGCAGAGATGGACGTGAGGAACGCCATTGTCCTCTTCTCCCTCTCTGCTGCCGGCGTCACGCAGGAGCTGGCCATCTCCCGCCGGCAGCGCCGCGTCCCGGGGAACCTGATGGGCTCCTACAGGTCGGTGGGGGTGGAGACAGGGGAGACGAAGAAGGAGGGGGCAGCCCGCTCAGGAGGCCAGGGGGGCATCCGTGCCCGGCTCAGGCCCATCGACGCAGACACCATTGACATTTACGCCCGCGCTGTGTTCCCTGCGGCGTTTGCGGCCGTCAATGTCATCTACTGGGCGGCATACGCCATGTGA
ORF Protein Sequence MDAPARLLAPLLLLCAQQLRGTRAMNDIGDYVGSNLEISWLPNLDGLIAGYARNFRPGIGGPPVNVALALEVASIDHISEANMEYTMTVFLHQSWRDSRLSYNHTNETLGLDSRFVDKLWLPDTFIVNAKSAWFHDVTVENKLIRLQPDGVILYSIRITSTVACDMDLAKYPMDEQECMLDLESYGYSSEDIVYYWSESQEHIHGLDKLQLAQFTITSYRFTTELMNFKSAGQFPRLSLHFHLRRNRGVYIIQSYMPSVLLVAMSWVSFWISQAAVPARVSLGITTVLTMTTLMVSARSSLPRASAIKALDVYFWICYVFVFAALVEYAFAHFNADYRKKQKAKVKVSRPRAEMDVRNAIVLFSLSAAGVTQELAISRRQRRVPGNLMGSYRSVGVETGETKKEGAARSGGQGGIRARLRPIDADTIDIYARAVFPAAFAAVNVIYWAAYAM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27376-Ab Anti-GBRD/ GABRD/ EIG10 monoclonal antibody
    Target Antigen GM-Tg-g-T27376-Ag GABRD VLP (virus-like particle)
    ORF Viral Vector pGMLP003715 Human GABRD Lentivirus plasmid
    ORF Viral Vector pGMLP004093 Human GABRD Lentivirus plasmid
    ORF Viral Vector pGMLV001902 Human GABRD Lentivirus plasmid
    ORF Viral Vector vGMLP003715 Human GABRD Lentivirus particle
    ORF Viral Vector vGMLP004093 Human GABRD Lentivirus particle
    ORF Viral Vector vGMLV001902 Human GABRD Lentivirus particle


    Target information

    Target ID GM-T27376
    Target Name GABRD
    Gene ID 2563, 14403, 710062, 29689, 101087589, 489609, 508711, 100064300
    Gene Symbol and Synonyms EIG10,EJM7,GABAA-RD,GABRD,GEFSP5
    Uniprot Accession O14764
    Uniprot Entry Name GBRD_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000187730
    Target Classification Not Available

    Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.