Human CCL24/Ckb-6/MPIF-2 ORF/cDNA clone-Lentivirus particle (NM_002991)
SKU: vGMLP003812
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCL24/Ckb-6/MPIF-2 Lentiviral expression plasmid for CCL24 lentivirus packaging, CCL24 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CCL24/Ckb-6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003812 | Human CCL24 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003812 |
Gene Name | CCL24 |
Accession Number | NM_002991 |
Gene ID | 6369 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 360 bp |
Gene Alias | Ckb-6,MPIF-2,MPIF2,SCYA24 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCAGGCCTGATGACCATAGTAACCAGCCTTCTGTTCCTTGGTGTCTGTGCCCACCACATCATCCCTACGGGCTCTGTGGTCATCCCCTCTCCCTGCTGCATGTTCTTTGTTTCCAAGAGAATTCCTGAGAACCGAGTGGTCAGCTACCAGCTGTCCAGCAGGAGCACATGCCTCAAGGCAGGAGTGATCTTCACCACCAAGAAGGGCCAGCAGTTCTGTGGCGACCCCAAGCAGGAGTGGGTCCAGAGGTACATGAAGAACCTGGACGCCAAGCAGAAGAAGGCTTCCCCTAGGGCCAGGGCAGTGGCTGTCAAGGGCCCTGTCCAGAGATATCCTGGCAACCAAACCACCTGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0070-Ab | Anti-CCL24/ Ckb-6/ MPIF-2 functional antibody |
Target Antigen | GM-Tg-g-SE0070-Ag | CCL24 protein |
Cytokine | cks-Tg-g-GM-SE0070 | chemokine (C-C motif) ligand 24 (CCL24) protein & antibody |
ORF Viral Vector | pGMLP003812 | Human CCL24 Lentivirus plasmid |
ORF Viral Vector | vGMLP003812 | Human CCL24 Lentivirus particle |
Target information
Target ID | GM-SE0070 |
Target Name | CCL24 |
Gene ID | 6369, 56221, 716050, 288593, 101086275, 445452, 617258, 100061208 |
Gene Symbol and Synonyms | CCL24,Ckb-6,MPIF-2,MPIF2,SCYA24 |
Uniprot Accession | O00175 |
Uniprot Entry Name | CCL24_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000106178 |
Target Classification | Not Available |
This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. Finally, the protein is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.