Human CCL24/Ckb-6/MPIF-2 ORF/cDNA clone-Lentivirus particle (NM_002991)

SKU: vGMLP003812
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL24/Ckb-6/MPIF-2 Lentiviral expression plasmid for CCL24 lentivirus packaging, CCL24 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCL24/Ckb-6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003812 Human CCL24 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003812
Gene Name CCL24
Accession Number NM_002991
Gene ID 6369
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 360 bp
Gene Alias Ckb-6,MPIF-2,MPIF2,SCYA24
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGGCCTGATGACCATAGTAACCAGCCTTCTGTTCCTTGGTGTCTGTGCCCACCACATCATCCCTACGGGCTCTGTGGTCATCCCCTCTCCCTGCTGCATGTTCTTTGTTTCCAAGAGAATTCCTGAGAACCGAGTGGTCAGCTACCAGCTGTCCAGCAGGAGCACATGCCTCAAGGCAGGAGTGATCTTCACCACCAAGAAGGGCCAGCAGTTCTGTGGCGACCCCAAGCAGGAGTGGGTCCAGAGGTACATGAAGAACCTGGACGCCAAGCAGAAGAAGGCTTCCCCTAGGGCCAGGGCAGTGGCTGTCAAGGGCCCTGTCCAGAGATATCCTGGCAACCAAACCACCTGCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0070-Ab Anti-CCL24/ Ckb-6/ MPIF-2 functional antibody
    Target Antigen GM-Tg-g-SE0070-Ag CCL24 protein
    Cytokine cks-Tg-g-GM-SE0070 chemokine (C-C motif) ligand 24 (CCL24) protein & antibody
    ORF Viral Vector pGMLP003812 Human CCL24 Lentivirus plasmid
    ORF Viral Vector vGMLP003812 Human CCL24 Lentivirus particle


    Target information

    Target ID GM-SE0070
    Target Name CCL24
    Gene ID 6369, 56221, 716050, 288593, 101086275, 445452, 617258, 100061208
    Gene Symbol and Synonyms CCL24,Ckb-6,MPIF-2,MPIF2,SCYA24
    Uniprot Accession O00175
    Uniprot Entry Name CCL24_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000106178
    Target Classification Not Available

    This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. Finally, the protein is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.