Human IL1RL1/DER4/FIT-1 ORF/cDNA clone-Lentivirus particle (NM_016232)

Cat. No.: vGMLP003795

Pre-made Human IL1RL1/DER4/FIT-1 Lentiviral expression plasmid for IL1RL1 lentivirus packaging, IL1RL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IL1RL1/DER4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003795 Human IL1RL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003795
Gene Name IL1RL1
Accession Number NM_016232
Gene ID 9173
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1671 bp
Gene Alias DER4,FIT-1,IL33R,ST2,ST2L,ST2V,T1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGTTTTGGATCTTAGCAATTCTCACAATTCTCATGTATTCCACAGCAGCAAAGTTTAGTAAACAATCATGGGGCCTGGAAAATGAGGCTTTAATTGTAAGATGTCCTAGACAAGGAAAACCTAGTTACACCGTGGATTGGTATTACTCACAAACAAACAAAAGTATTCCCACTCAGGAAAGAAATCGTGTGTTTGCCTCAGGCCAACTTCTGAAGTTTCTACCAGCTGCAGTTGCTGATTCTGGTATTTATACCTGTATTGTCAGAAGTCCCACATTCAATAGGACTGGATATGCGAATGTCACCATATATAAAAAACAATCAGATTGCAATGTTCCAGATTATTTGATGTATTCAACAGTATCTGGATCAGAAAAAAATTCCAAAATTTATTGTCCTACCATTGACCTCTACAACTGGACAGCACCTCTTGAGTGGTTTAAGAATTGTCAGGCTCTTCAAGGATCAAGGTACAGGGCGCACAAGTCATTTTTGGTCATTGATAATGTGATGACTGAGGACGCAGGTGATTACACCTGTAAATTTATACACAATGAAAATGGAGCCAATTATAGTGTGACGGCGACCAGGTCCTTCACGGTCAAGGATGAGCAAGGCTTTTCTCTGTTTCCAGTAATCGGAGCCCCTGCACAAAATGAAATAAAGGAAGTGGAAATTGGAAAAAACGCAAACCTAACTTGCTCTGCTTGTTTTGGAAAAGGCACTCAGTTCTTGGCTGCCGTCCTGTGGCAGCTTAATGGAACAAAAATTACAGACTTTGGTGAACCAAGAATTCAACAAGAGGAAGGGCAAAATCAAAGTTTCAGCAATGGGCTGGCTTGTCTAGACATGGTTTTAAGAATAGCTGACGTGAAGGAAGAGGATTTATTGCTGCAGTACGACTGTCTGGCCCTGAATTTGCATGGCTTGAGAAGGCACACCGTAAGACTAAGTAGGAAAAATCCAATTGATCATCATAGCATCTACTGCATAATTGCAGTATGTAGTGTATTTTTAATGCTAATCAATGTCCTGGTTATCATCCTAAAAATGTTCTGGATTGAGGCCACTCTGCTCTGGAGAGACATAGCTAAACCTTACAAGACTAGGAATGATGGAAAGCTCTATGATGCTTATGTTGTCTACCCACGGAACTACAAATCCAGTACAGATGGGGCCAGTCGTGTAGAGCACTTTGTTCACCAGATTCTGCCTGATGTTCTTGAAAATAAATGTGGCTATACCTTATGCATTTATGGGAGAGATATGCTACCTGGAGAAGATGTAGTCACTGCAGTGGAAACCAACATACGAAAGAGCAGGCGGCACATTTTCATCCTGACCCCTCAGATCACTCACAATAAGGAGTTTGCCTACGAGCAGGAGGTTGCCCTGCACTGTGCCCTCATCCAGAACGACGCCAAGGTGATACTTATTGAGATGGAGGCTCTGAGCGAGCTGGACATGCTGCAGGCTGAGGCGCTTCAGGACTCCCTCCAGCATCTTATGAAAGTACAGGGGACCATCAAGTGGAGGGAGGACCACATTGCCAATAAAAGGTCCCTGAATTCTAAATTCTGGAAGCACGTGAGGTACCAAATGCCTGTGCCAAGCAAAATTCCCAGAAAGGCCTCTAGTTTGACTCCCTTGGCTGCCCAGAAGCAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-033 Pre-Made Astegolimab biosimilar, Whole mAb, Anti-IL1RL1/ST2 Antibody: Anti-DER4/FIT-1/IL33R/T1 therapeutic antibody
    Biosimilar GMP-Bios-ab-340 Pre-Made Melrilimab biosimilar, Whole mAb, Anti-IL1RL1/ST2 Antibody: Anti-DER4/FIT-1/IL33R/T1 therapeutic antibody
    Target Antibody GM-Tg-g-MP0622-Ab Anti-ILRL1/ IL1RL1/ DER4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0622-Ag IL1RL1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP0622 interleukin 1 receptor-like 1 (IL1RL1) protein & antibody
    ORF Viral Vector pGMLP003795 Human IL1RL1 Lentivirus plasmid
    ORF Viral Vector vGMLP003795 Human IL1RL1 Lentivirus particle


    Target information

    Target ID GM-MP0622
    Target Name IL1RL1
    Gene ID 9173, 17082, 711893, 25556, 101080448, 611442, 520709, 100058357
    Gene Symbol and Synonyms DER4,FIT-1,FIT1,IL1RL1,IL33R,Ly84,ST2,St2-rs1,ST2L,ST2V,T1,T1/ST2
    Uniprot Accession Q01638
    Uniprot Entry Name ILRL1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000115602
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.