Human HRH1/H1-R/H1R ORF/cDNA clone-Lentivirus particle (NM_001098213)

SKU: vGMLP003757
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HRH1/H1-R/H1R Lentiviral expression plasmid for HRH1 lentivirus packaging, HRH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to H1R/HRH1/H1-R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003757 Human HRH1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003757
Gene Name HRH1
Accession Number NM_001098213
Gene ID 3269
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1464 bp
Gene Alias H1-R,H1R,HH1R,hisH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCTCCCCAATTCCTCCTGCCTCTTAGAAGACAAGATGTGTGAGGGCAACAAGACCACTATGGCCAGCCCCCAGCTGATGCCCCTGGTGGTGGTCCTGAGCACTATCTGCTTGGTCACAGTAGGGCTCAACCTGCTGGTGCTGTATGCCGTACGGAGTGAGCGGAAGCTCCACACTGTGGGGAACCTGTACATCGTCAGCCTCTCGGTGGCGGACTTGATCGTGGGTGCCGTCGTCATGCCTATGAACATCCTCTACCTGCTCATGTCCAAGTGGTCACTGGGCCGTCCTCTCTGCCTCTTTTGGCTTTCCATGGACTATGTGGCCAGCACAGCGTCCATTTTCAGTGTCTTCATCCTGTGCATTGATCGCTACCGCTCTGTCCAGCAGCCCCTCAGGTACCTTAAGTATCGTACCAAGACCCGAGCCTCGGCCACCATTCTGGGGGCCTGGTTTCTCTCTTTTCTGTGGGTTATTCCCATTCTAGGCTGGAATCACTTCATGCAGCAGACCTCGGTGCGCCGAGAGGACAAGTGTGAGACAGACTTCTATGATGTCACCTGGTTCAAGGTCATGACTGCCATCATCAACTTCTACCTGCCCACCTTGCTCATGCTCTGGTTCTATGCCAAGATCTACAAGGCCGTACGACAACACTGCCAGCACCGGGAGCTCATCAATAGGTCCCTCCCTTCCTTCTCAGAAATTAAGCTGAGGCCAGAGAACCCCAAGGGGGATGCCAAGAAACCAGGGAAGGAGTCTCCCTGGGAGGTTCTGAAAAGGAAGCCAAAAGATGCTGGTGGTGGATCTGTCTTGAAGTCACCATCCCAAACCCCCAAGGAGATGAAATCCCCAGTTGTCTTCAGCCAAGAGGATGATAGAGAAGTAGACAAACTCTACTGCTTTCCACTTGATATTGTGCACATGCAGGCTGCGGCAGAGGGGAGTAGCAGGGACTATGTAGCCGTCAACCGGAGCCATGGCCAGCTCAAGACAGATGAGCAGGGCCTGAACACACATGGGGCCAGCGAGATATCAGAGGATCAGATGTTAGGTGATAGCCAATCCTTCTCTCGAACGGACTCAGATACCACCACAGAGACAGCACCAGGCAAAGGCAAATTGAGGAGTGGGTCTAACACAGGCCTGGATTACATCAAGTTTACTTGGAAGAGGCTCCGCTCGCATTCAAGACAGTATGTATCTGGGTTGCACATGAACCGCGAAAGGAAGGCCGCCAAACAGTTGGGTTTTATCATGGCAGCCTTCATCCTCTGCTGGATCCCTTATTTCATCTTCTTCATGGTCATTGCCTTCTGCAAGAACTGTTGCAATGAACATTTGCACATGTTCACCATCTGGCTGGGCTACATCAACTCCACACTGAACCCCCTCATCTACCCCTTGTGCAATGAGAACTTCAAGAAGACATTCAAGAGAATTCTGCATATTCGCTCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77913-Ab Anti-HRH1/ H1R/ H1-R monoclonal antibody
    Target Antigen GM-Tg-g-T77913-Ag H1R/HRH1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003757 Human HRH1 Lentivirus plasmid
    ORF Viral Vector vGMLP003757 Human HRH1 Lentivirus particle


    Target information

    Target ID GM-T77913
    Target Name H1R
    Gene ID 3269, 15465, 696359, 24448, 101088314, 403813, 281231, 100034110
    Gene Symbol and Synonyms Bphs,H1,H1-R,H1R,HH1R,Hir,hisH1,Hisr,HRH1
    Uniprot Accession P35367
    Uniprot Entry Name HRH1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000196639
    Target Classification GPCR

    Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.