Human GLP1R/GLP-1/ GLP-1-R ORF/cDNA clone-Lentivirus particle (NM_002062)
Pre-made Human GLP1R/GLP-1/ GLP-1-R Lentiviral expression plasmid for GLP1R lentivirus packaging, GLP1R lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to GLP1R/GLP-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003729 | Human GLP1R Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003729 |
Gene Name | GLP1R |
Accession Number | NM_002062 |
Gene ID | 2740 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1392 bp |
Gene Alias | GLP-1, GLP-1-R, GLP-1R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGGCGCCCCCGGCCCGCTGCGCCTTGCGCTGCTGCTGCTCGGGATGGTGGGCAGGGCCGGCCCCCGCCCCCAGGGTGCCACTGTGTCCCTCTGGGAGACGGTGCAGAAATGGCGAGAATACCGACGCCAGTGCCAGCGCTCCCTGACTGAGGATCCACCTCCTGCCACAGACTTGTTCTGCAACCGGACCTTCGATGAATACGCCTGCTGGCCAGATGGGGAGCCAGGCTCGTTCGTGAATGTCAGCTGCCCCTGGTACCTGCCCTGGGCCAGCAGTGTGCCGCAGGGCCACGTGTACCGGTTCTGCACAGCTGAAGGCCTCTGGCTGCAGAAGGACAACTCCAGCCTGCCCTGGAGGGACTTGTCGGAGTGCGAGGAGTCCAAGCGAGGGGAAAGAAGCTCCCCGGAGGAGCAGCTCCTGTTCCTCTACATCATCTACACGGTGGGCTACGCACTCTCCTTCTCTGCTCTGGTTATCGCCTCTGCGATCCTCCTCGGCTTCAGACACCTGCACTGCACCAGGAACTACATCCACCTGAACCTGTTTGCATCCTTCATCCTGCGAGCATTGTCCGTCTTCATCAAGGACGCAGCCCTGAAGTGGATGTATAGCACAGCCGCCCAGCAGCACCAGTGGGATGGGCTCCTCTCCTACCAGGACTCTCTGAGCTGCCGCCTGGTGTTTCTGCTCATGCAGTACTGTGTGGCGGCCAATTACTACTGGCTCTTGGTGGAGGGCGTGTACCTGTACACACTGCTGGCCTTCTCGGTCTTATCTGAGCAATGGATCTTCAGGCTCTACGTGAGCATAGGCTGGGGTGTTCCCCTGCTGTTTGTTGTCCCCTGGGGCATTGTCAAGTACCTCTATGAGGACGAGGGCTGCTGGACCAGGAACTCCAACATGAACTACTGGCTCATTATCCGGCTGCCCATTCTCTTTGCCATTGGGGTGAACTTCCTCATCTTTGTTCGGGTCATCTGCATCGTGGTATCCAAACTGAAGGCCAATCTCATGTGCAAGACAGACATCAAATGCAGACTTGCCAAGTCCACGCTGACACTCATCCCCCTGCTGGGGACTCATGAGGTCATCTTTGCCTTTGTGATGGACGAGCACGCCCGGGGGACCCTGCGCTTCATCAAGCTGTTTACAGAGCTCTCCTTCACCTCCTTCCAGGGGCTGATGGTGGCCATATTATACTGCTTTGTCAACAATGAGGTCCAGCTGGAATTTCGGAAGAGCTGGGAGCGCTGGCGGCTTGAGCACTTGCACATCCAGAGGGACAGCAGCATGAAGCCCCTCAAGTGTCCCACCAGCAGCCTGAGCAGTGGAGCCACGGCGGGCAGCAGCATGTACACAGCCACTTGCCAGGCCTCCTGCAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-895 | |
Biosimilar | GMP-Bios-INN-724 | Pre-Made Albiglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-1)2 Peptide-Albumin(Alb) Fusion Protein targetingGLP-1-R/GLP-1R |
Biosimilar | GMP-Bios-INN-824 | |
Biosimilar | GMP-Bios-INN-817 | |
Biosimilar | GMP-Bios-INN-806 | Pre-Made Dulaglutide Biosimilar, Peptide Protein Fusion targeting GLP1R: (Glp-12) Peptide-Human Igg4 Fc Fusion Protein targeting GLP-1/GLP-1-R/GLP-1R |
Target Antibody | GM-Tg-g-T36075-Ab | Anti-GLP1R/ GLP-1/ GLP-1-R monoclonal antibody |
Target Antigen | GM-Tg-g-T36075-Ag | GLP1R VLP (virus-like particle) |
ORF Viral Vector | pGMLP003729 | Human GLP1R Lentivirus plasmid |
ORF Viral Vector | vGMLP003729 | Human GLP1R Lentivirus particle |
Target information
Target ID | GM-T36075 |
Target Name | GLP1R |
Gene ID | 2740, 14652, 719548, 25051, 101095495, 481778, 517420, 100065307 |
Gene Symbol and Synonyms | Glip,GLP-1,GLP-1-R,GLP-1R,GLP1R,GLP1Rc,RATGL1RCP |
Uniprot Accession | P43220 |
Uniprot Entry Name | GLP1R_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000112164 |
Target Classification | GPCR |
This gene encodes a 7-transmembrane protein that functions as a receptor for glucagon-like peptide 1 (GLP-1) hormone, which stimulates glucose-induced insulin secretion. This receptor, which functions at the cell surface, becomes internalized in response to GLP-1 and GLP-1 analogs, and it plays an important role in the signaling cascades leading to insulin secretion. It also displays neuroprotective effects in animal models. Polymorphisms in this gene are associated with diabetes. The protein is an important drug target for the treatment of type 2 diabetes and stroke. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.