Human HTR2C/5-HT1C/5-HT2C ORF/cDNA clone-Lentivirus particle (NM_000868)
SKU: vGMLP003724
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human HTR2C/5-HT1C/5-HT2C Lentiviral expression plasmid for HTR2C lentivirus packaging, HTR2C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HTR2C/5-HT1C products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003724 | Human HTR2C Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003724 |
Gene Name | HTR2C |
Accession Number | NM_000868 |
Gene ID | 3358 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1377 bp |
Gene Alias | 5-HT1C,5-HT2C,5-HTR2C,5HTR2C,HTR1C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGAACCTGAGGAATGCGGTGCATTCATTCCTTGTGCACCTAATTGGCCTATTGGTTTGGCAATGTGATATTTCTGTGAGCCCAGTAGCAGCTATAGTAACTGACATTTTCAATACCTCCGATGGTGGACGCTTCAAATTCCCAGACGGGGTACAAAACTGGCCAGCACTTTCAATCGTCATCATAATAATCATGACAATAGGTGGCAACATCCTTGTGATCATGGCAGTAAGCATGGAAAAGAAACTGCACAATGCCACCAATTACTTCTTAATGTCCCTAGCCATTGCTGATATGCTAGTGGGACTACTTGTCATGCCCCTGTCTCTCCTGGCAATCCTTTATGATTATGTCTGGCCACTACCTAGATATTTGTGCCCCGTCTGGATTTCTTTAGATGTTTTATTTTCAACAGCGTCCATCATGCACCTCTGCGCTATATCGCTGGATCGGTATGTAGCAATACGTAATCCTATTGAGCATAGCCGTTTCAATTCGCGGACTAAGGCCATCATGAAGATTGCTATTGTTTGGGCAATTTCTATAGGTGTATCAGTTCCTATCCCTGTGATTGGACTGAGGGACGAAGAAAAGGTGTTCGTGAACAACACGACGTGCGTGCTCAACGACCCAAATTTCGTTCTTATTGGGTCCTTCGTAGCTTTCTTCATACCGCTGACGATTATGGTGATTACGTATTGCCTGACCATCTACGTTCTGCGCCGACAAGCTTTGATGTTACTGCACGGCCACACCGAGGAACCGCCTGGACTAAGTCTGGATTTCCTGAAGTGCTGCAAGAGGAATACGGCCGAGGAAGAGAACTCTGCAAACCCTAACCAAGACCAGAACGCACGCCGAAGAAAGAAGAAGGAGAGACGTCCTAGGGGCACCATGCAGGCTATCAACAATGAAAGAAAAGCTTCGAAAGTCCTTGGGATTGTTTTCTTTGTGTTTCTGATCATGTGGTGCCCATTTTTCATTACCAATATTCTGTCTGTTCTTTGTGAGAAGTCCTGTAACCAAAAGCTCATGGAAAAGCTTCTGAATGTGTTTGTTTGGATTGGCTATGTTTGTTCAGGAATCAATCCTCTGGTGTATACTCTGTTCAACAAAATTTACCGAAGGGCATTCTCCAACTATTTGCGTTGCAATTATAAGGTAGAGAAAAAGCCTCCTGTCAGGCAGATTCCAAGAGTTGCCGCCACTGCTTTGTCTGGGAGGGAGCTTAATGTTAACATTTATCGGCATACCAATGAACCGGTGATCGAGAAAGCCAGTGACAATGAGCCCGGTATAGAGATGCAAGTTGAGAATTTAGAGTTACCAGTAAATCCCTCCAGTGTGGTTAGCGAAAGGATTAGCAGTGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T83813-Ab | Anti-5HT2C/ HTR2C/ 5-HT1C monoclonal antibody |
Target Antigen | GM-Tg-g-T83813-Ag | HTR2C VLP (virus-like particle) |
ORF Viral Vector | pGMLP003724 | Human HTR2C Lentivirus plasmid |
ORF Viral Vector | vGMLP003724 | Human HTR2C Lentivirus particle |
Target information
Target ID | GM-T83813 |
Target Name | HTR2C |
Gene ID | 3358, 15560, 708141, 25187, 101099620, 450240, 538909, 100057852 |
Gene Symbol and Synonyms | 5-HT-1C,5-HT-2C,5-HT1C,5-HT2C,5-HT2cR,5-HTR2C,5HT-1C,5HT1c,5HT2C,5HTR2C,HTR1C,HTR2C,SR1 |
Uniprot Accession | P28335 |
Uniprot Entry Name | 5HT2C_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000147246 |
Target Classification | GPCR |
This gene encodes a seven-transmembrane G-protein-coupled receptor. The encoded protein responds to signaling through the neurotransmitter serotonin. The mRNA of this gene is subject to multiple RNA editing events, where adenosine residues encoded by the genome are converted to inosines. RNA editing is predicted to alter the structure of the second intracellular loop, thereby generating alternate protein forms with decreased ability to interact with G proteins. Abnormalities in RNA editing of this gene have been detected in victims of suicide that suffer from depression. In addition, naturally-occuring variation in the promoter and 5' non-coding and coding regions of this gene may show statistically-significant association with mental illness and behavioral disorders. Alternative splicing results in multiple different transcript variants. [provided by RefSeq, Jan 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.