Human SERPINB13/headpin/ HSHUR7SEQ ORF/cDNA clone-Lentivirus particle (NM_012397)

Pre-made Human SERPINB13/headpin/ HSHUR7SEQ Lentiviral expression plasmid for SERPINB13 lentivirus packaging, SERPINB13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SERPINB13/headpin products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003637 Human SERPINB13 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003637
Gene Name SERPINB13
Accession Number NM_012397
Gene ID 5275
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1176 bp
Gene Alias headpin, HSHUR7SEQ, HUR7, PI13
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATTCACTTGGCGCCGTCAGCACTCGACTTGGGTTTGATCTTTTCAAAGAGCTGAAGAAAACAAATGATGGCAACATCTTCTTTTCCCCTGTGGGCATCTTGACTGCAATTGGCATGGTCCTCCTGGGGACCCGAGGAGCCACCGCTTCCCAGTTGGAGGAGGTGTTTCACTCTGAAAAAGAGACGAAGAGCTCAAGAATAAAGGCTGAAGAAAAAGAGGTGATTGAGAACACAGAAGCAGTACATCAACAATTCCAAAAGTTTTTGACTGAAATAAGCAAACTCACTAATGATTATGAACTGAACATAACCAACAGGCTGTTTGGAGAAAAAACATACCTCTTCCTTCAAAAATACTTAGATTATGTTGAAAAATATTATCATGCATCTCTGGAACCTGTTGATTTTGTAAATGCAGCCGATGAAAGTCGAAAGAAGATTAATTCCTGGGTTGAAAGCAAAACAAATGAAAAAATCAAGGACTTGTTCCCAGATGGCTCTATTAGTAGCTCTACCAAGCTGGTGCTGGTGAACATGGTTTATTTTAAAGGGCAATGGGACAGGGAGTTTAAGAAAGAAAATACTAAGGAAGAGAAATTTTGGATGAATAAGAGCACAAGTAAATCTGTACAGATGATGACACAGAGCCATTCCTTTAGCTTCACTTTCCTGGAGGACTTGCAGGCCAAAATTCTAGGGATTCCATATAAAAACAACGACCTAAGCATGTTTGTGCTTCTGCCCAACGACATCGATGGCCTGGAGAAGATAATAGATAAAATAAGTCCTGAGAAATTGGTAGAGTGGACTAGTCCAGGGCATATGGAAGAAAGAAAGGTGAATCTGCACTTGCCCCGGTTTGAGGTGGAGGACGGTTACGATCTAGAGGCGGTCCTGGCTGCCATGGGGATGGGCGATGCCTTCAGTGAGCACAAAGCCGACTACTCGGGAATGTCGTCAGGCTCCGGGTTGTACGCCCAGAAGTTCCTGCACAGTTCCTTTGTGGCAGTAACTGAGGAAGGCACCGAGGCTGCAGCTGCCACCGGCATAGGCTTTACTGTCACATCCGCCCCAGGTCATGAAAATGTTCACTGCAATCATCCCTTCCTGTTCTTCATCAGGCACAATGAATCCAACAGCATCCTCTTCTTCGGCAGATTTTCTTCTCCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1616-Ab Anti-SERPINB13 monoclonal antibody
    Target Antigen GM-Tg-g-IP1616-Ag SERPINB13 protein
    ORF Viral Vector pGMLP003637 Human SERPINB13 Lentivirus plasmid
    ORF Viral Vector vGMLP003637 Human SERPINB13 Lentivirus particle


    Target information

    Target ID GM-IP1616
    Target Name SERPINB13
    Gene ID 5275, 241196, 701078, 304690, 101084064, 483955, 100051229
    Gene Symbol and Synonyms 5430417G24,headpin,HSHUR7SEQ,HUR7,HURPIN,PI13,SERPINB13
    Uniprot Accession Q9UIV8
    Uniprot Entry Name SPB13_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000197641
    Target Classification Not Available

    The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.